Allograpta nasuta

(Macquart, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allograpta

At a glance

Occurrence records285

Data sources6

Biological traits0

DNA specimens33

eDNA detections9

Sources6 archives

Databases and archives Allograpta nasuta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF285 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD33 specimens

01Narrative

Allograpta nasuta là một loài ruồi trong họ Ruồi giả ong (Syrphidae). Loài này được Macquart mô tả khoa học đầu tiên năm 1842. Allograpta nasuta phân bố ở vùng Châu Phi

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allograpta nasuta has left across the world's sequence archives.

At a glance

DNA specimens33

BINs4

Marker genes1

eDNA detections9

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 135 variable positions, in barcode order

4Cmostly conserved

16Tmostly conserved

19Amostly conserved

31Avariable

34Tvariable

40Tmostly conserved

41Gmostly conserved

43Amostly conserved

44Tmostly conserved

52Tvariable

55Avariable

58Amostly conserved

59Cmostly conserved

61Tmostly conserved

64Tvariable

70Avariable

73Tvariable

76Tvariable

91Cvariable

106Avariable

112Tmostly conserved

115Amostly conserved

121Tmostly conserved

124Tmostly conserved

128Gmostly conserved

130Amostly conserved

139Tmostly conserved

154Tmostly conserved

163Tmostly conserved

169Amostly conserved

182Cvariable

184Tvariable

191Tmostly conserved

193Amostly conserved

197Cvariable

205Tvariable

208Tmostly conserved

214Gvariable

220Tmostly conserved

244Tmostly conserved

248Tmostly conserved

251Tmostly conserved

256Tmostly conserved

259Avariable

268Tvariable

272Cvariable

274Tvariable

275Tmostly conserved

278Gmostly conserved

283Tmostly conserved

286Amostly conserved

292Tvariable

307Amostly conserved

310Tmostly conserved

313Tmostly conserved

319Amostly conserved

322Tmostly conserved

325Tmostly conserved

328Tmostly conserved

332Cmostly conserved

334Tmostly conserved

337Tmostly conserved

338Gmostly conserved

339Cmostly conserved

340Tmostly conserved

342Gmostly conserved

343Avariable

349Tmostly conserved

352Tmostly conserved

353Gmostly conserved

355Tvariable

358Gvariable

361Amostly conserved

364Tmostly conserved

367Amostly conserved

376Avariable

385Tmostly conserved

386Tmostly conserved

388Amostly conserved

392Tvariable

395Gmostly conserved

397Avariable

403Amostly conserved

406Tmostly conserved

409Amostly conserved

418Avariable

421Tmostly conserved

430Tmostly conserved

433Tmostly conserved

436Tvariable

439Amostly conserved

440Gmostly conserved

442Avariable

457Amostly conserved

458Amostly conserved

459Amostly conserved

460Tvariable

463Tmostly conserved

467Tmostly conserved

469Tvariable

472Tmostly conserved

475Cvariable

493Tvariable

499Amostly conserved

502Avariable

504Tmostly conserved

505Amostly conserved

511Tmostly conserved

515Tmostly conserved

518Tvariable

520Amostly conserved

523Tmostly conserved

524Cmostly conserved

526Tmostly conserved

527Tmostly conserved

529Amostly conserved

532Amostly conserved

533Tvariable

538Tvariable

541Avariable

+15 more variable positions not shown

ATTCGGAGCTTGAGCTGGAATAGTAGGAACATCTTTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCAGGTGCTTTAATTGGAGATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.4%

Haplotypes9

BINs3

Most divergent pair11.4%

AsiaN.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allograpta fuscotibialissame genus2.2%Allograpta calopoidessame genus3.4%Allograpta nigripilosasame genus3.9%Allograpta javanasame genus4.0%Allograpta australensissame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type285 records

Wild obs. + sensor38

Museum / vouchered247

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 17≤1 km 4≤10 km 6>10 km 9

36 georeferenced · 2 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 17

17 georeferenced · 230 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	156
KwaZulu-Natal Museumlocation not on record	43
National Biodiversity Institute, Costa Ricalocation not on record	21
Durban Natural Science Museumlocation not on record	4
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
Tapachula, MX	1
International Centre of Insect Physiology and Ecologylocation not on record	1

7 institutions · 228 of 247 vouchered records shown · 19 without an institution code

09Environmental DNA9 detections

Where the DNA of Allograpta nasuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 18.0–21.0

Seasonal swing summer↔winter1.60 °C

Max temp (day)24.1 °C 23.4–24.8

Min temp (night)15.1 °C 12.7–17.5

Precipitation378 mm/mo 169–586

Air humidity64.9 % 57.7–72.0

Moisture balance248 mm/mo 25.4–471

Vapour deficit779 Pa 690–869

Wind speed1.80 m/s 0.7–2.90

Cloud cover36.5 % 27.9–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)