Allograpta calopoides

(Curran, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allograpta

At a glance

Occurrence records64

Data sources5

Biological traits0

DNA specimens5

eDNA detections2

Sources5 archives

Databases and archives Allograpta calopoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allograpta calopoides has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

184Cvariable

484Gvariable

TACATTATATTTTCTATTCGGAGCTTGAGCTGGAATAGTAGGAACCTCTTTAAGTGTATTGATTCGTGCAGAACTTGGTCATCCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allograpta fuscotibialissame genus2.9%Allograpta nasutasame genus3.4%Allograpta nigripilosasame genus5.3%Allograpta javanasame genus5.3%Allograpta australensissame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor5

Museum / vouchered59

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 12

12 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Museums of Kenyalocation not on record	27
KwaZulu-Natal Museumlocation not on record	20

2 institutions · 47 of 59 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Allograpta calopoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)