Allograpta fuscotibialis

(Macquart, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allograpta

At a glance

Occurrence records235

Data sources6

Biological traits0

DNA specimens22

eDNA detections7

Sources6 archives

Databases and archives Allograpta fuscotibialis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD22 specimens

01Narrative

Allograpta fuscotibialis là một loài ruồi trong họ Ruồi giả ong (Syrphidae). Loài này được Macquart mô tả khoa học đầu tiên năm 1842. Allograpta fuscotibialis phân bố ở vùng Châu Phi

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allograpta fuscotibialis has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes3

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 105 variable positions, in barcode order

2Amostly conserved

12Cmostly conserved

23Tmostly conserved

25Gmostly conserved

29Tmostly conserved

36Gmostly conserved

44Cmostly conserved

53Tmostly conserved

54Gmostly conserved

56Amostly conserved

65Tmostly conserved

68Amostly conserved

72Cmostly conserved

74Tmostly conserved

77Tmostly conserved

86Tmostly conserved

89Tmostly conserved

104Cvariable

119Amostly conserved

125Tmostly conserved

134Cmostly conserved

137Tmostly conserved

152Tmostly conserved

195Cmostly conserved

197Tmostly conserved

204Tmostly conserved

206Amostly conserved

210Cmostly conserved

218Tmostly conserved

221Tmostly conserved

230Amostly conserved

254Tmostly conserved

264Cmostly conserved

269Tmostly conserved

272Amostly conserved

281Tmostly conserved

285Cmostly conserved

287Tmostly conserved

296Tmostly conserved

299Amostly conserved

305Tmostly conserved

323Tmostly conserved

326Tmostly conserved

332Amostly conserved

335Tmostly conserved

345Cmostly conserved

347Tmostly conserved

350Tmostly conserved

351Gmostly conserved

352Cmostly conserved

355Gmostly conserved

356Tmostly conserved

362Tmostly conserved

365Tmostly conserved

368Tmostly conserved

371Avariable

374Amostly conserved

377Tmostly conserved

380Amostly conserved

389Amostly conserved

398Tmostly conserved

399Tmostly conserved

401Amostly conserved

405Tmostly conserved

408Gmostly conserved

410Amostly conserved

419Tmostly conserved

431Gvariable

434Tmostly conserved

449Tmostly conserved

452Amostly conserved

455Amostly conserved

467Amostly conserved

468Tmostly conserved

472Gvariable

473Tmostly conserved

476Tmostly conserved

480Tmostly conserved

515Amostly conserved

517Tmostly conserved

518Amostly conserved

524Tmostly conserved

528Tmostly conserved

536Tmostly conserved

537Cmostly conserved

539Tmostly conserved

540Tmostly conserved

542Amostly conserved

545Amostly conserved

546Tmostly conserved

554Amostly conserved

560Amostly conserved

576Cmostly conserved

578Tmostly conserved

584Tmostly conserved

590Tmostly conserved

602Cmostly conserved

605Tmostly conserved

614Tmostly conserved

617Amostly conserved

620Tmostly conserved

629Tmostly conserved

632Cmostly conserved

635Amostly conserved

644Tmostly conserved

CATTATATTTTCTATTTGGAGCTTGAGCTGGAATAGTAGGAACCTCTTTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCAGGTGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes5

BIN1

Most divergent pair13.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allograpta nasutasame genus2.2%Allograpta calopoidessame genus2.9%Allograpta nigripilosasame genus4.3%Allograpta javanasame genus4.4%Allograpta terraenovaesame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type235 records

Wild obs. + sensor17

Museum / vouchered218

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 14≤1 km 1≤10 km 1

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KwaZulu-Natal Museumlocation not on record	163
Helsinki, FI	38
Cape Town, ZA	7
University of KwaZulu-Natallocation not on record	1

4 institutions · 209 of 218 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Allograpta fuscotibialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 17.3–22.3

Seasonal swing summer↔winter8.50 °C

Max temp (day)24.8 °C 20.0–26.3

Min temp (night)15.3 °C 14.5–18.3

Precipitation132 mm/mo 80.4–145

Air humidity63.4 % 60.0–65.6

Moisture balance-25.1 mm/mo -60.4–-7.40

Vapour deficit860 Pa 736–1,014

Wind speed2.70 m/s 2.10–5.10

Cloud cover34.5 % 16.8–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)