Allantus viennensis

(Schrank, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Allantus

At a glance

Occurrence records427

Data sources6

Biological traits0

DNA specimens14

eDNA detections14

Sources6 archives

Databases and archives Allantus viennensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 7 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Allantus viennensis is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1781 door Schrank.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allantus viennensis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs3

Marker genes1

eDNA detections14

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 106 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

14Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Tmostly conserved

25Cmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

45Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

51Tmostly conserved

52Cvariable

54Gmostly conserved

55Amostly conserved

56Amostly conserved

58Amostly conserved

59Cvariable

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Tmostly conserved

82Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Cmostly conserved

98Gmostly conserved

99Gmostly conserved

100Amostly conserved

101Amostly conserved

110Cmostly conserved

127Avariable

133Tmostly conserved

235Cmostly conserved

259Tmostly conserved

271Tvariable

280Tmostly conserved

283Tmostly conserved

293Gmostly conserved

301Amostly conserved

319Amostly conserved

322Amostly conserved

346Avariable

347Cmostly conserved

361Cvariable

376Amostly conserved

394Tmostly conserved

433Amostly conserved

463Tvariable

466Amostly conserved

526Amostly conserved

529Avariable

532Tvariable

544Gvariable

547Amostly conserved

548Tmostly conserved

556Amostly conserved

574Tvariable

595Tmostly conserved

616Cvariable

631Avariable

646Tmostly conserved

652Cmostly conserved

AACACTATACTTTATTTTCGGATTCTGATCAGGTATATTAGGATTATCATTCAGAATACTAATTCGTATAGAATTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes4

BINs3

Most divergent pair4.0%

AsiaN.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allantus togatussame genus11.4%Eutomostethus ephippiumsame family12.2%Strongylogaster multicinctasame family12.5%Ametastegia apertasame family12.6%Euura acutiserrasame family13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type427 records

Wild obs. + sensor409

Museum / vouchered18

Range

Area of Occupancy AOO1 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 74≤1 km 55≤10 km 176>10 km 13

318 georeferenced · 91 without coordinates

Open the mapobservation + sensor409

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1≤10 km 1

4 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	4
Zürich, CH	2
University Park, US	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
OSUClocation not on record	1
Provincia di Livornolocation not on record	1

6 institutions · 10 of 18 vouchered records shown · 8 without an institution code

09Environmental DNA14 detections

Where the DNA of Allantus viennensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map7 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 14.5–27.8

Seasonal swing summer↔winter19.1 °C

Max temp (day)23.0 °C 17.8–33.6

Min temp (night)14.1 °C 9.50–20.6

Precipitation74.6 mm/mo 12.3–115

Air humidity58.0 % 43.4–59.6

Moisture balance-47.4 mm/mo -194–-36.8

Vapour deficit907 Pa 680–2,140

Wind speed2.90 m/s 2.20–5.20

Cloud cover34.3 % 19.6–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)