Eutomostethus ephippium

(Panzer, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Eutomostethus

At a glance

Occurrence records7 106

Data sources7

Biological traits0

DNA specimens82

eDNA detections107

Sources7 archives

Databases and archives Eutomostethus ephippium's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics82 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 106 records

Environmental DNA4 datasets · 16 countries107 detections

DNA & barcodingBOLD82 specimens

01Narrative

Eutomostethus ephippium is a species of common sawfly in the family Tenthredinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding82 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eutomostethus ephippium has left across the world's sequence archives.

At a glance

DNA specimens82

BINs2

Marker genes1

eDNA detections107

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

25Cmostly conserved

34Gmostly conserved

44Tmostly conserved

442Cmostly conserved

634Tmostly conserved

AACTTTATATTTTATTTTTGGATTCTGATCAGGGATATTAGGATTATCATTTAGAATATTAATTCGAATAGAATTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes8

BINs2

Most divergent pair4.1%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia apertasame family10.5%Ametastegia pulchellasame family10.6%Empria sexpunctatasame family11.5%Ametastegia pallipessame family11.6%Dolerus hibernicussame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 106 records

Wild obs. + sensor6 703

Museum / vouchered402

Other1

Range

Area of Occupancy AOO12 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 1 504≤1 km 770≤10 km 3 497>10 km 115

5 886 georeferenced · 817 without coordinates

Open the mapobservation + sensor6 703

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 95≤1 km 48≤10 km 113>10 km 6

262 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence402

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	55
BioFokuslocation not on record	43
Zürich, CH	41
ZMAAlocation not on record	40
Tilburg, NL	35
Champaign, US	25
Oulu, FI	15
SLU Artdatabankenlocation not on record	11
Helsinki, FI	10
OSUClocation not on record	10
ZSMlocation not on record	9
Natural History Museum Rotterdamlocation not on record	7
Philadelphia, US	6
DFFW2018location not on record	5
MZLUlocation not on record	5
NEFlocation not on record	4
neflocation not on record	4
Institute of Zoology Slovak Academy of Scienceslocation not on record	4
University of Central Floridalocation not on record	3
South Kensington, GB	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Vancouver, CA	1
Nijmegen, NL	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
University of Oulu, Zoological Museumlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Guelphlocation not on record	1

28 institutions · 343 of 402 vouchered records shown · 59 without an institution code

09Environmental DNA107 detections

Where the DNA of Eutomostethus ephippium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys4

Countries16

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map16 countries0

WetlandForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 9.50–18.1

Seasonal swing summer↔winter19.1 °C

Max temp (day)17.9 °C 13.1–22.4

Min temp (night)10.0 °C 5.60–13.6

Precipitation78.1 mm/mo 40.3–103

Air humidity59.3 % 57.1–61.9

Moisture balance-38.1 mm/mo -60.9–1.10

Vapour deficit664 Pa 498–858

Wind speed3.30 m/s 2.30–4.50

Cloud cover40.9 % 33.5–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eutomostethus ephippium

At a glance

Sources7 archives

At a glance

Record type7 106 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 106 records