Allagelena gracilens

(C.L.Koch, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Allagelena

At a glance

Occurrence records2 532

Data sources9

Biological traits9

DNA specimens38

eDNA detections40

Sources9 archives

Databases and archives Allagelena gracilens's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 532 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

World Spider Trait DBMasaryk University9 traits · 15 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements15 literature sources9 traits

Occurrence & distributionGBIF2 532 records

Environmental DNA1 datasets · 7 countries40 detections

DNA & barcodingBOLD38 specimens

01Narrative

Allagelena gracilens is a spider species found in Europe and eastward to Central Asia.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 15 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Staręga et al. 2001Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a

Morphometry1

Body length♀10·♂7.5 mm

Predation2

Hunting guildsheet web weavers

Prey diversity1.78 mm

Ecology6

Light0.875 mm

Light 2partly shaded

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryIndeterminate (IN)

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allagelena gracilens has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes2

eDNA detections40

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

178Tmostly conserved

217Amostly conserved

218Gmostly conserved

271Tmostly conserved

280Amostly conserved

286Amostly conserved

289Gmostly conserved

335Gmostly conserved

343Tmostly conserved

370Tmostly conserved

376Amostly conserved

390Cmostly conserved

466Gmostly conserved

478Amostly conserved

494Amostly conserved

497Cmostly conserved

550Amostly conserved

583Gmostly conserved

631Amostly conserved

GACTTTGTATTTGATTTTTGGGGCTTGATCTGCTATAGTGGGTACAGCTATGAGAGTTTTAATTCGGATTGAGTTAGGGCAACCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes10

BIN1

Most divergent pair2.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allagelena difficilissame genus7.8%Agelena orientalissame family8.7%Agelena labyrinthicasame family9.0%Tortolena glaucopissame family10.0%Lagunella guaycurasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 532 records

Wild obs. + sensor2 352

Museum / vouchered176

Cultivated / captive1

Other3

Origin

Native100

Range

Area of Occupancy AOO6 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 729≤1 km 309≤10 km 616>10 km 83

1 737 georeferenced · 615 without coordinates

Open the mapobservation + sensor2 352

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 6≤1 km 10≤10 km 49>10 km 1

66 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence176

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	18
Frankfurt am Main	17
Adam Mickiewicz University in Poznańlocation not on record	14
Bonn, DE	12
	6
Ekaterinburg, RU	4
Washington, US	3
Musee d'Histoire Naturallelocation not on record	2
Uniwersytet w Białymstokulocation not on record	2
Bern, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
ZSMlocation not on record	1
Helsinki, FI	1
SNSDlocation not on record	1
Geneva, CH	1
Bavarian State Collection of Zoologylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1

18 institutions · 89 of 176 vouchered records shown · 80 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA40 detections

Where the DNA of Allagelena gracilens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map7 countries0

UrbanTagebaufolgelandschaftWaldrand

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 11.4–21.0

Seasonal swing summer↔winter20.2 °C

Max temp (day)22.2 °C 15.4–24.6

Min temp (night)13.6 °C 5.40–17.2

Precipitation78.0 mm/mo 50.1–112

Air humidity59.3 % 57.0–61.1

Moisture balance-28.4 mm/mo -86.1–-8.30

Vapour deficit828 Pa 540–1,069

Wind speed2.90 m/s 2.40–3.60

Cloud cover39.0 % 33.3–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allagelena gracilens

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology6

At a glance

Record type2 532 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 532 records