Agelena labyrinthica

(Clerck, 1757) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Agelena

At a glance

Occurrence records15 383

Data sources9

Biological traits56

DNA specimens51

eDNA detections81

Sources9 archives

Databases and archives Agelena labyrinthica's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

World Spider Trait DBMasaryk University56 traits · 32 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements32 literature sources56 traits

Occurrence & distributionGBIF15 383 records

Environmental DNA3 datasets · 11 countries81 detections

DNA & barcodingBOLD51 specimens

01Narrative

Agelena labyrinthica is a species of spider in the family Agelenidae. It is a widespread species in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 32 sources

Wolff et al. 2022Pekár 2014aBirkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Staręga et al. 2001Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Gajdoš et al. 2014Henriksen & Hilmo 2015SLU 2020Lemke et al. 2013Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Roberts 1995Kovblyuk & Kastrygina 2011Blauwe de 1980Tanikawa 2005aNentwig et al. 2018Cardoso et al. 2011Birkhofer & Wolters 2012Pekár et al. 2012a

Morphometry38

ALE0.26 mm

AME0.28 mm

Abdomen length6.7 mm

Abdomen width4.6 mm

Body length♀13.25·♂11 mm

Cephalothorax height2.75 mm

Cephalothorax length5.06 mm

Cephalothorax width3.56 mm

Chelicerae basal part (paturon) length1.98 mm

Femur I length4.56 mm

Femur I width0.86 mm

Femur II length4.42 mm

Femur III length4.26 mm

Femur IV length5.45 mm

Leg I length16.37 mm

Leg II length15.27 mm

Leg III length14.79 mm

Leg IV length19.76 mm

Metatarsus I length4.08 mm

Metatarsus II length3.86 mm

Metatarsus III length3.97 mm

Metatarsus IV length6.04 mm

PLE0.24 mm

PME0.22 mm

Patella I length1.78 mm

Patella II length1.78 mm

Patella III length1.65 mm

Patella IV length1.75 mm

Tarsus I length2.17 mm

Tarsus II length1.98 mm

Tarsus III length1.87 mm

Tarsus IV length2.33 mm

Tibia I length3.72 mm

Tibia I width0.61 mm

Tibia II length3.42 mm

Tibia III length3.1 mm

Tibia IV length4.24 mm

Tibia IV width0.63 mm

Predation6

Hunting guildsheet web weavers

Hunting guild 2sheet web builder

Prey OrderLepidoptera

Prey diversity5.68 mm

Simple hunting guild classificationweb-building

Web buildingyes

Ecology9

Ballooninghigh

Circadian activitydiurnal

Light0.75 mm

Light 2partly shaded

Moisture 10.375 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categoryLeast Concern (*)

Stratumsurface

Biomechanics1

'Primary mode of locomotionwalking

Defence1

Retreatcrevice

Morphology1

Cribellumabsent

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelena labyrinthica has left across the world's sequence archives.

At a glance

DNA specimens51

BINs4

Marker genes3

eDNA detections81

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

7Amostly conserved

14Amostly conserved

28Gmostly conserved

43Gmostly conserved

46Gvariable

85Gmostly conserved

88Amostly conserved

97Amostly conserved

100Gmostly conserved

127Tmostly conserved

160Gmostly conserved

163Tmostly conserved

169Amostly conserved

173Tmostly conserved

181Gvariable

196Amostly conserved

202Tmostly conserved

208Amostly conserved

214Amostly conserved

241Gvariable

244Gmostly conserved

271Avariable

274Tmostly conserved

280Amostly conserved

284Cvariable

289Gvariable

307Gmostly conserved

316Gmostly conserved

322Amostly conserved

325Tmostly conserved

328Tmostly conserved

343Tmostly conserved

349Gmostly conserved

364Tmostly conserved

373Tmostly conserved

403Avariable

433Gmostly conserved

466Gmostly conserved

469Tmostly conserved

472Gvariable

478Gmostly conserved

487Amostly conserved

496Tmostly conserved

502Amostly conserved

508Tmostly conserved

535Gmostly conserved

544Amostly conserved

547Tmostly conserved

559Gvariable

577Gvariable

586Tmostly conserved

625Amostly conserved

643Gmostly conserved

GACTTTATATTTAATTTTTGGGGCTTGGTCTGCTATAGTGGGGACGGCTATAAGAGTATTGATTCGAATTGAATTAGGACAACCGGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes13

BINs4

Most divergent pair7.3%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelena orientalissame genus7.1%Allagelena gracilenssame family9.0%Tortolena glaucopissame family9.1%Cicurina tersasame order11.6%Thyenula tenebricasame order11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type15 383 records

Wild obs. + sensor14 201

Museum / vouchered1 148

Cultivated / captive2

Other32

Origin

Native272

Introduced1

Range

Area of Occupancy AOO34 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 4 881≤1 km 1 971≤10 km 4 563>10 km 232

11 647 georeferenced · 2 554 without coordinates

Open the mapobservation + sensor14 201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 49≤1 km 42≤10 km 462>10 km 8

561 georeferenced · 587 without coordinates

Open the institutions mapphysical evidence1 148

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adam Mickiewicz University in Poznańlocation not on record	236
Brussels, BE	138
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	44
Frankfurt am Main	41
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	39
Bonn, DE	28
NSMKlocation not on record	25
SLU Artdatabankenlocation not on record	21
Bern, CH	20
Tartu, EE	19
Copenhagen, DK	18
Ekaterinburg, RU	14
Akademia Pomorska w Słupskulocation not on record	13
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	11
Uniwersytet w Białymstokulocation not on record	10
Tilburg, NL	9
South Kensington, GB	9
SNSDlocation not on record	9
Zoologisches Museum Hamburglocation not on record	8
Paro, BT	8
Helsinki, FI	7
MZLUlocation not on record	7
BioFokuslocation not on record	5
	5
Kushiro City Museumlocation not on record	4
ZSMlocation not on record	3
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Natural History Museum, Londonlocation not on record	2
Washington, US	2
Centre for Biodiversity Genomicslocation not on record	2
Champaign, US	2
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Ghent, BE	1
University of Genevalocation not on record	1
KIBSlocation not on record	1

37 institutions · 770 of 1 148 vouchered records shown · 378 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA81 detections

Where the DNA of Agelena labyrinthica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys3

Countries11

Verifiable raw sequence linked27

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map11 countries0

meadows (dry), forest, edge of foreststrukturreiches Offenlandmixed forest with understorey, pastures

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 9.50–22.6

Seasonal swing summer↔winter19.8 °C

Max temp (day)21.0 °C 14.0–28.1

Min temp (night)13.4 °C 4.00–17.3

Precipitation63.9 mm/mo 29.4–109

Air humidity59.8 % 49.5–63.2

Moisture balance-43.9 mm/mo -126–1.40

Vapour deficit792 Pa 468–1,380

Wind speed3.60 m/s 2.40–4.50

Cloud cover41.6 % 27.8–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agelena labyrinthica

At a glance

Sources9 archives

Morphometry38

Predation6

Ecology9

Biomechanics1

Defence1

Morphology1

At a glance

Record type15 383 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 383 records