Agelena orientalis

C.L.Koch, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Agelenidae/Agelena

At a glance

Occurrence records354

Data sources10

Biological traits0

DNA specimens34

eDNA detections24

Sources10 archives

Databases and archives Agelena orientalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF354 records

Environmental DNA1 datasets · 3 countries24 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈6.5 Gbp

01Narrative

Agelena orientalis is a species of spiders belonging to the family Agelenidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelena orientalis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

5Tmostly conserved

40Tmostly conserved

79Gmostly conserved

88Amostly conserved

121Amostly conserved

148Gmostly conserved

163Amostly conserved

169Gmostly conserved

181Cmostly conserved

196Amostly conserved

202Cmostly conserved

214Gmostly conserved

306Cmostly conserved

316Gmostly conserved

343Cmostly conserved

364Tmostly conserved

373Tmostly conserved

547Tmostly conserved

553Cmostly conserved

GACTTTGTATTTAGTTTTTGGGGCTTGATCTGCTATAGTTGGTACAGCTATAAGAGTATTGATTCGAATTGAATTAGGGCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes9

BINs2

Most divergent pair2.9%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelena labyrinthicasame genus7.1%Allagelena gracilenssame family8.7%Allagelena difficilissame family9.7%Tortolena glaucopissame family9.9%Eratigena saevasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agelena orientalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈6 488 071 994 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Agelena orientalis6.49 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type354 records

Wild obs. + sensor280

Museum / vouchered74

Origin

Introduced1

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 144≤1 km 53≤10 km 23>10 km 11

231 georeferenced · 49 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	9
Helsinki, FI	3
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
Frankfurt am Main	1

4 institutions · 14 of 74 vouchered records shown · 57 without an institution code

09Environmental DNA24 detections

Where the DNA of Agelena orientalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map3 countries0

forest edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 15.6–25.5

Seasonal swing summer↔winter19.0 °C

Max temp (day)22.2 °C 20.0–28.3

Min temp (night)16.4 °C 9.40–21.6

Precipitation36.7 mm/mo 5.60–80.5

Air humidity59.4 % 46.9–62.4

Moisture balance-65.8 mm/mo

Vapour deficit1,041 Pa 697–1,468

Wind speed4.10 m/s

Cloud cover26.7 % 11.2–33.2

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)