Alebra wahlbergi

(Boheman, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Alebra

At a glance

Occurrence records991

Data sources6

Biological traits2

DNA specimens88

eDNA detections194

Sources6 archives

Databases and archives Alebra wahlbergi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI194 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF991 records

Environmental DNA4 datasets · 10 countries194 detections

DNA & barcodingBOLD88 specimens

01Narrative

Alebra wahlbergi is een cicade behorend tot de familie dwergcicaden (Cicadellidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alebra wahlbergi has left across the world's sequence archives.

At a glance

DNA specimens88

BINs1

Marker genes1

eDNA detections194

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

86Tmostly conserved

89Tmostly conserved

185Tmostly conserved

260Gmostly conserved

288Cmostly conserved

373Tmostly conserved

410Amostly conserved

CTATATACTTCATTTTTGGTATTTGATCAGGAATTGTTGGTATAATACTAAGAATATTGATTCGAGTTGAATTAGCCCAACCTGGTTCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes5

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alebra albostriellasame genus4.4%Alebra thoracicasame genus10.6%Hebata solanisame family16.9%Hebata affinissame family16.9%Matsumurasca papayaesame family17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type991 records

Wild obs. + sensor833

Museum / vouchered157

Other1

Range

Area of Occupancy AOO2 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 190≤1 km 112≤10 km 98

400 georeferenced · 433 without coordinates

Open the mapobservation + sensor833

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 86≤1 km 38≤10 km 11

135 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence157

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	14
MZLUlocation not on record	8
SLU Artdatabankenlocation not on record	8
Museo universitario di Scienze della Terra di Romalocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
BioFokuslocation not on record	3
NHMOlocation not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

11 institutions · 50 of 157 vouchered records shown · 107 without an institution code

09Environmental DNA194 detections

Where the DNA of Alebra wahlbergi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found194

Studies independent surveys4

Countries10

Verifiable raw sequence linked108

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 194 detections have coordinates

Open the map10 countries0

Urban14. Artificial - Terrestrial | 14.5 Urban Ar…14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 13.9–17.2

Seasonal swing summer↔winter17.5 °C

Max temp (day)19.6 °C 17.4–21.6

Min temp (night)11.1 °C 9.50–13.8

Precipitation67.8 mm/mo 54.5–103

Air humidity60.7 % 58.5–63.0

Moisture balance-50.3 mm/mo -67.1–6.40

Vapour deficit698 Pa 586–807

Wind speed3.40 m/s 2.40–4.30

Cloud cover43.0 % 36.9–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 194 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)