Alebra thoracica

Hamilton, 1995 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Alebra

At a glance

Occurrence records100

Data sources5

Biological traits0

DNA specimens84

eDNA detections82

Sources5 archives

Databases and archives Alebra thoracica's data was compiled from.

GBIFGlobal Biodiversity Information Facility100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF100 records

Environmental DNA1 datasets · 2 countries82 detections

DNA & barcodingBOLD84 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alebra thoracica has left across the world's sequence archives.

At a glance

DNA specimens84

BINs2

Marker genes1

eDNA detections82

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

38Gmostly conserved

282Tmostly conserved

AACTATATATTTCATTTTTGGTATTTGGTCCGGGATTGTTGGTATAATATTAAGAATATTAATTCGTGTTGAATTAGCCCAATCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes5

BINs2

Most divergent pair8.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alebra wahlbergisame genus10.6%Alebra albostriellasame genus11.9%Matsumurasca papayaesame family16.3%Idiocerus alternatussame family17.8%Idiocerus nervatussame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type100 records

Museum / vouchered100

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 7

7 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence100

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	36
Mississippi State, US	10
Centre for Biodiversity Genomicslocation not on record	1
CNClocation not on record	1

4 institutions · 48 of 100 vouchered records shown · 52 without an institution code

09Environmental DNA82 detections

Where the DNA of Alebra thoracica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 23.7–25.7

Min temp (night)13.4 °C 13.4–16.0

Precipitation83.0 mm/mo 83.0–95.1

Air humidity57.0 % 57.0–57.6

Moisture balance-61.2 mm/mo -61.2–-59.1

Vapour deficit888 Pa 888–1,016

Wind speed3.40 m/s 3.20–3.40

Cloud cover41.5 % 39.0–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)