Alebra albostriella

(Fallén, 1826) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Alebra

At a glance

Occurrence records1 432

Data sources5

Biological traits2

DNA specimens20

eDNA detections1

Sources5 archives

Databases and archives Alebra albostriella's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 432 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD20 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alebra albostriella has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ACTATATACTTCATTTTTGGTATTTGATCAGGAATTGTTGGTATAATATTAAGAATATTAATTCGAGTTGAATTAGCTCAACCTGGGTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alebra wahlbergisame genus4.4%Alebra thoracicasame genus11.9%Tremulicerus mesopyrrhussame family16.8%Matsumurasca papayaesame family17.5%Hebata solanisame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 432 records

Wild obs. + sensor1 140

Museum / vouchered290

Other2

Range

Area of Occupancy AOO3 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 434≤1 km 150≤10 km 194

778 georeferenced · 362 without coordinates

Open the mapobservation + sensor1 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 42≤1 km 112≤10 km 71

225 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	52
Museo universitario di Scienze della Terra di Romalocation not on record	39
Champaign, US	38
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	26
MZLUlocation not on record	26
SLU Artdatabankenlocation not on record	24
NHMOlocation not on record	21
Tartu, EE	12
Metsähallituslocation not on record	10
Philadelphia, US	8
BioFokuslocation not on record	4
Bonn, DE	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Stockholm, SE	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Tilburg, NL	1

16 institutions · 266 of 290 vouchered records shown · 24 without an institution code

09Environmental DNA1 detections

Where the DNA of Alebra albostriella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Stor eik.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter22.0 °C

Max temp (day)20.2 °C

Min temp (night)13.2 °C

Precipitation103 mm/mo

Air humidity61.8 %

Moisture balance19.4 mm/mo

Vapour deficit738 Pa

Wind speed2.40 m/s

Cloud cover44.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alebra albostriella

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 432 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 432 records