Agulla unicolor

Carpenter, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Raphidioptera/Raphidiidae/Agulla

At a glance

Occurrence records250

Data sources6

Biological traits0

DNA specimens222

eDNA detections227

Sources6 archives

Databases and archives Agulla unicolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI227 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics222 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF250 records

Environmental DNA1 datasets · 2 countries227 detections

DNA & barcodingBOLD222 specimens

01Narrative

Agulla (Glavia) unicolor is een kameelhalsvliegensoort uit de familie van de Raphidiidae. De soort komt voor in het Nearctisch gebied. Agulla (Glavia) unicolor werd voor het eerst wetenschappelijk beschreven door Carpenter in 1936.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding222 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agulla unicolor has left across the world's sequence archives.

At a glance

DNA specimens222

BINs2

Marker genes1

eDNA detections227

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus213 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

43Amostly conserved

52Tmostly conserved

55Gmostly conserved

67Cmostly conserved

76Amostly conserved

82Tmostly conserved

130Tmostly conserved

139Cmostly conserved

190Tmostly conserved

265Amostly conserved

271Cmostly conserved

274Tmostly conserved

343Cmostly conserved

373Amostly conserved

559Cmostly conserved

631Tmostly conserved

ACTATACTTTATTTTTGGTGCATGATCAGGAATAATTGGAACATCTCTAAGTCTGTTAATTCGATCCGAATTAGGATCACCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes19

BINs2

Most divergent pair3.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agulla arizonicasame genus10.9%Agulla adnixasame genus11.0%Agulla bicolorsame genus13.9%Gyrinus distinctussame order16.2%Holobus flavicornissame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type250 records

Wild obs. + sensor44

Museum / vouchered206

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 15≤1 km 6≤10 km 4>10 km 7

32 georeferenced · 12 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 1≤10 km 23>10 km 13

37 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	59
University of Central Floridalocation not on record	43
Cambridge, US	35
Vancouver, CA	31
College Station, US	26
Centre for Biodiversity Genomicslocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Provincia di Livornolocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
Lexington, US	1

10 institutions · 204 of 206 vouchered records shown · 2 without an institution code

09Environmental DNA227 detections

Where the DNA of Agulla unicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found227

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 227 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate ForestGrassland4. Native Grassland | 4.4. Temperate Grassland3. Shrubland|3.4. Temperate Shrubland1. Forest & Woodland|1.4. Forest - Temperate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 13.4–21.2

Seasonal swing summer↔winter25.5 °C

Max temp (day)25.7 °C 20.5–28.8

Min temp (night)10.0 °C 6.20–13.2

Precipitation39.3 mm/mo 23.3–66.3

Air humidity45.0 % 45.0–51.3

Moisture balance-122 mm/mo -147–-63.6

Vapour deficit1,161 Pa 785–1,295

Wind speed2.80 m/s 2.20–2.90

Cloud cover29.5 % 29.5–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 224 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)