Agulla arizonica

(Banks, 1911) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Raphidioptera/Raphidiidae/Agulla

At a glance

Occurrence records18

Data sources6

Biological traits0

DNA specimens120

eDNA detections127

Sources6 archives

Databases and archives Agulla arizonica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI127 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics120 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 2 countries127 detections

DNA & barcodingBOLD120 specimens

01Narrative

Agulla (Agulla) arizonica is een kameelhalsvliegensoort uit de familie van de Raphidiidae. De soort komt voor in het zuidwesten van de Verenigde Staten. Agulla (Agulla) arizonica werd voor het eerst wetenschappelijk beschreven door Banks in 1911.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding120 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agulla arizonica has left across the world's sequence archives.

At a glance

DNA specimens120

BINs2

Marker genes1

eDNA detections127

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

235Cmostly conserved

334Gmostly conserved

413Avariable

TTTATACTTTATTTTTGGAGCTTGATCTGGTATAATTGGAACATCTCTAAGATTATTAATTCGATCTGAATTAGGATCACCTGGATCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes6

BINs2

Most divergent pair11.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agulla adnixasame genus4.4%Agulla unicolorsame genus10.9%Eurybela scotopissame order15.7%Glycythyma chrysoryctasame order16.4%Bradina melanoperassame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_070270 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type18 records

Museum / vouchered18

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence18

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Provincia di Livornolocation not on record	3
Centre for Biodiversity Genomicslocation not on record	2

4 institutions · 14 of 18 vouchered records shown · 4 without an institution code

09Environmental DNA127 detections

Where the DNA of Agulla arizonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found127

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 127 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland3. Shrubland|3.4. Temperate Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 12.0–21.2

Seasonal swing summer↔winter25.1 °C

Max temp (day)23.2 °C 18.5–28.8

Min temp (night)9.10 °C 5.90–13.2

Precipitation47.3 mm/mo 23.3–84.0

Air humidity51.3 % 45.0–53.8

Moisture balance-106 mm/mo -155–-51.0

Vapour deficit874 Pa 649–1,295

Wind speed2.30 m/s 2.20–2.90

Cloud cover37.7 % 29.5–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 124 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)