Agulla adnixa

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Raphidioptera/Raphidiidae/Agulla

At a glance

Occurrence records353

Data sources6

Biological traits0

DNA specimens87

eDNA detections88

Sources6 archives

Databases and archives Agulla adnixa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF353 records

Environmental DNA1 datasets · 2 countries88 detections

DNA & barcodingBOLD87 specimens

01Narrative

Agulla (Glavia) adnixa is een kameelhalsvliegensoort uit de familie van de Raphidiidae. De soort komt voor in het Nearctisch gebied. Agulla (Glavia) adnixa werd voor het eerst wetenschappelijk beschreven door Hagen in 1861.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agulla adnixa has left across the world's sequence archives.

At a glance

DNA specimens87

BINs2

Marker genes1

eDNA detections88

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

64Cvariable

175Tmostly conserved

259Gmostly conserved

397Tmostly conserved

425Cmostly conserved

TTTATATTTTATTTTTGGTGCTTGATCTGGTATGATTGGAACATCTCTAAGATTATTAATTCGCTCTGAATTAGGATCACCTGGATCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes4

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agulla arizonicasame genus4.4%Agulla unicolorsame genus11.0%Glycythyma chrysoryctasame order15.9%Bradina diagonalissame order16.4%Evergestis pallidatasame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type353 records

Wild obs. + sensor20

Museum / vouchered333

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 5≤1 km 6≤10 km 1>10 km 1

13 georeferenced · 7 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 15≤10 km 39>10 km 2

56 georeferenced · 277 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	101
Vancouver, CA	98
Universidad Católica de Manizaleslocation not on record	50
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
University of Central Floridalocation not on record	9
Wuzhou, CN	6
Mississippi State, US	3
University of Alberta Museums (UAM)location not on record	3
Provincia di Livornolocation not on record	2
Royal British Columbia Museumlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Lexington, US	1
Washington, US	1
Champaign, US	1

14 institutions · 300 of 333 vouchered records shown · 33 without an institution code

09Environmental DNA88 detections

Where the DNA of Agulla adnixa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland5. Wetlands (inland)1. Forest & Woodland|1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 13.9–21.2

Seasonal swing summer↔winter25.1 °C

Max temp (day)24.4 °C 20.9–28.8

Min temp (night)11.2 °C 7.00–13.2

Precipitation35.4 mm/mo 23.3–53.9

Air humidity52.2 % 48.6–53.2

Moisture balance-106 mm/mo -155–-91.1

Vapour deficit985 Pa 785–1,295

Wind speed2.50 m/s 2.20–2.80

Cloud cover38.6 % 29.9–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)