Agrypnia colorata

(Hagen, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Phryganeidae/Agrypnia

At a glance

Occurrence records324

Data sources5

Biological traits0

DNA specimens160

eDNA detections157

Sources5 archives

Databases and archives Agrypnia colorata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility324 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI157 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics160 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF324 records

Environmental DNA1 datasets · 3 countries157 detections

DNA & barcodingBOLD160 specimens

01Narrative

Agrypnia colorata is een schietmot uit de familie Phryganeidae. De soort komt voor in het Palearctisch en het Nearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding160 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrypnia colorata has left across the world's sequence archives.

At a glance

DNA specimens160

BINs2

Marker genes4

eDNA detections157

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus154 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

82Tmostly conserved

127Tvariable

220Cmostly conserved

226Cvariable

232Cmostly conserved

265Amostly conserved

283Tmostly conserved

334Gmostly conserved

340Cmostly conserved

352Tmostly conserved

361Cmostly conserved

370Avariable

412Gmostly conserved

448Tmostly conserved

463Cmostly conserved

484Tmostly conserved

499Cmostly conserved

508Tmostly conserved

526Cvariable

544Cmostly conserved

565Avariable

577Gmostly conserved

586Cmostly conserved

622Gvariable

631Amostly conserved

637Tmostly conserved

AACTATTTATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACTTCACTAAGAATAATTATCCGAACAGAATTAGGAACTTCTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes19

BINs2

Most divergent pair5.0%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrypnia hayfordaesame genus8.7%Agrypnia vestitasame genus11.9%Agrypnia sahlbergisame genus11.9%Banksiola smithisame family12.1%Agrypnia obsoletasame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCADHEF1-alphaRPB2

animal barcodemarker

08Occurrence & distribution

Record type324 records

Wild obs. + sensor3

Museum / vouchered321

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 4≤10 km 16>10 km 4

32 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence321

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	112
Champaign, US	15
Toronto, CA	14
Vancouver, CA	11
University of Alberta Museums (UAM)location not on record	4
SLU Artdatabankenlocation not on record	4
Montréal, CA	4
Centre for Biodiversity Genomicslocation not on record	2
Colorado State Universitylocation not on record	2
University Park, US	1

10 institutions · 169 of 321 vouchered records shown · 152 without an institution code

09Environmental DNA157 detections

Where the DNA of Agrypnia colorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found157

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 157 detections have coordinates

Open the map3 countries0

Riparian ZoneGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.2–16.9

Seasonal swing summer↔winter34.4 °C

Max temp (day)18.2 °C 14.2–22.4

Min temp (night)9.70 °C 7.00–13.0

Precipitation81.6 mm/mo 81.6–89.7

Air humidity60.5 % 60.0–62.6

Moisture balance-26.2 mm/mo -53.5–-9.00

Vapour deficit646 Pa 466–770

Wind speed2.30 m/s 2.20–3.50

Cloud cover44.1 % 39.2–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 156 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)