Agrypnia obsoleta

(Hagen, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Phryganeidae/Agrypnia

At a glance

Occurrence records3 932

Data sources6

Biological traits2

DNA specimens44

eDNA detections58

Sources6 archives

Databases and archives Agrypnia obsoleta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 932 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 932 records

Environmental DNA3 datasets · 9 countries58 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT2n = 56

01Narrative

Agrypnia obsoleta is een schietmot uit de familie Phryganeidae. De soort komt voor in het Palearctisch en het Nearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)possible nectivore

Feeding guild (larval)omnivore

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrypnia obsoleta has left across the world's sequence archives.

At a glance

DNA specimens44

BINs3

Marker genes1

eDNA detections58

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

22Amostly conserved

38Gmostly conserved

40Amostly conserved

43Amostly conserved

54Gmostly conserved

91Cvariable

184Avariable

205Tmostly conserved

265Avariable

266Cmostly conserved

313Cmostly conserved

340Tmostly conserved

343Cmostly conserved

382Tmostly conserved

388Tmostly conserved

433Gmostly conserved

436Cmostly conserved

518Gmostly conserved

548Cmostly conserved

550Avariable

616Tmostly conserved

619Tmostly conserved

628Gvariable

641Tmostly conserved

646Tmostly conserved

652Cmostly conserved

AACTATTTATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGAATAATTATTCGAACAGAATTAGGAACTACTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes17

BINs3

Most divergent pair15.2%

AsiaEuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrypnia deflatasame genus2.9%Agrypnia sahlbergisame genus4.5%Agrypnia sordidasame genus9.3%Agrypnia pictasame genus9.4%Agrypnia variasame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Agrypnia obsoleta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 561×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 932 records

Wild obs. + sensor2 198

Museum / vouchered1 724

Fossil6

Other4

Origin

Native19

Range

Area of Occupancy AOO6 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 399≤1 km 258≤10 km 220>10 km 1

1 878 georeferenced · 320 without coordinates

Open the mapobservation + sensor2 198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 998≤1 km 170≤10 km 277>10 km 41

1 486 georeferenced · 238 without coordinates

Open the institutions mapphysical evidence1 724

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	509
SLU Artdatabankenlocation not on record	303
Tromsø, NO	164
Helsinki, FI	142
Zürich, CH	96
Natural History Museum Rotterdamlocation not on record	45
NHMOlocation not on record	40
Provincia di Livornolocation not on record	32
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	29
BioFokuslocation not on record	26
Stockholm, SE	25
Champaign, US	15
ZMAAlocation not on record	12
St. Paul, US	11
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Rovaniemi, FI	7
Metsähallituslocation not on record	3
Kuopio, FI	2
DanishLepidopterologicalSocietylocation not on record	2
Bern, CH	2
Edmonton, CA	2
Research Collection of Aki Rinnelocation not on record	2
Tilburg, NL	1
Philadelphia, US	1
Montréal, CA	1
Bavarian State Collection of Zoologylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Vancouver, CA	1
neflocation not on record	1

29 institutions · 1 484 of 1 724 vouchered records shown · 240 without an institution code

09Environmental DNA58 detections

Where the DNA of Agrypnia obsoleta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys3

Countries9

Verifiable raw sequence linked13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map9 countries0

Fen edgeRiparian zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 6.70–15.4

Seasonal swing summer↔winter22.1 °C

Max temp (day)15.7 °C 9.00–18.0

Min temp (night)9.00 °C 4.20–11.1

Precipitation99.8 mm/mo 63.3–154

Air humidity60.5 % 55.5–66.8

Moisture balance21.8 mm/mo -47.5–86.4

Vapour deficit597 Pa 324–682

Wind speed2.90 m/s 1.90–4.90

Cloud cover48.9 % 38.9–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 58 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrypnia obsoleta

At a glance

Sources6 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 932 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 932 records