Agrypnia deflata

(Milne, 1931) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Phryganeidae/Agrypnia

At a glance

Occurrence records163

Data sources4

Biological traits0

DNA specimens43

eDNA detections38

Sources4 archives

Databases and archives Agrypnia deflata's data was compiled from.

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF163 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD43 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrypnia deflata has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes5

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

220Amostly conserved

337Tmostly conserved

418Tmostly conserved

466Gvariable

518Gmostly conserved

535Cmostly conserved

619Tmostly conserved

AACTATTTATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGAATAATTATTCGAACAGAATTAGGAACTACTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes9

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrypnia obsoletasame genus2.9%Agrypnia sahlbergisame genus6.0%Agrypnia sordidasame genus9.4%Agrypnia pictasame genus10.2%Agrypnia improbasame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCADHEF1-alphaRPB2

animal barcoderibosomalmarker

08Occurrence & distribution

Record type163 records

Museum / vouchered163

Range

Area of Occupancy AOO300 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 1≤10 km 5>10 km 15

21 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence163

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	42
Toronto, CA	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	17
Montréal, CA	14
University of Alberta Museums (UAM)location not on record	12
St. Paul, US	11
Colorado State Universitylocation not on record	5
Champaign, US	5
Vancouver, CA	2
Centre for Biodiversity Genomicslocation not on record	2
University Park, US	1

11 institutions · 133 of 163 vouchered records shown · 30 without an institution code

09Environmental DNA38 detections

Where the DNA of Agrypnia deflata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1. Boreal Forestalder forestRiparian ZoneMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 10.0–15.7

Seasonal swing summer↔winter36.7 °C

Max temp (day)14.9 °C 14.2–21.7

Min temp (night)7.10 °C 4.90–11.9

Precipitation87.9 mm/mo 52.6–95.6

Air humidity61.6 % 52.7–63.4

Moisture balance-15.7 mm/mo -72.5–3.80

Vapour deficit498 Pa 452–776

Wind speed2.40 m/s 2.20–3.70

Cloud cover44.1 % 34.1–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)