Agrypnia vestita

(Walker, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Phryganeidae/Agrypnia

At a glance

Occurrence records366

Data sources8

Biological traits0

DNA specimens39

eDNA detections38

Sources8 archives

Databases and archives Agrypnia vestita's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility366 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF366 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT · NCBI≈1.4 Gbp

01Narrative

Agrypnia vestita is a species of giant caddisfly in the family Phryganeidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrypnia vestita has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes2

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

58Amostly conserved

166Avariable

187Cmostly conserved

235Cmostly conserved

340Tmostly conserved

343Tmostly conserved

361Tmostly conserved

433Amostly conserved

529Cmostly conserved

532Cvariable

580Gvariable

631Amostly conserved

AACAATTTATTTTATTTTTGGAATCTGAGCTGGTATAGTAGGAACTTCTTTAAGAATAATTATTCGAACAGAATTAGGAACTACTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes11

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrypnia macdunnoughisame genus8.8%Agrypnia stramineasame genus9.6%Agrypnia improbasame genus9.7%Agrypnia sahlbergisame genus10.4%Agrypnia obsoletasame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrypnia vestita carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 353 059 149 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrypnia vestita1.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type366 records

Wild obs. + sensor19

Museum / vouchered347

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 11≤1 km 4>10 km 1

16 georeferenced · 3 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 11≤1 km 68≤10 km 28>10 km 13

120 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	122
Champaign, US	108
Montréal, CA	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
Chicago, US	8
University of Guelphlocation not on record	3
Wuzhou, CN	3
Toronto, CA	3
Natural History Museum Rotterdamlocation not on record	3
Vancouver, CA	2
Washington, US	2
Cornell University Insect Collectionlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
CUlocation not on record	1
New Haven, US	1
College Station, US	1
University of Alberta Museums (UAM)location not on record	1
University Park, US	1

18 institutions · 311 of 347 vouchered records shown · 36 without an institution code

09Environmental DNA38 detections

Where the DNA of Agrypnia vestita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

Temperate mixed forestGrasslandWetlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 15.2–20.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.6 °C 19.9–25.0

Min temp (night)15.5 °C 11.8–17.8

Precipitation90.3 mm/mo 81.3–109

Air humidity59.1 % 57.9–64.6

Moisture balance-41.5 mm/mo -61.6–7.10

Vapour deficit865 Pa 683–1,016

Wind speed3.20 m/s 2.80–4.10

Cloud cover40.8 % 38.4–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)