Agrotis trux

Hübner · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records16 396

Data sources7

Biological traits2

DNA specimens78

eDNA detections77

Sources7 archives

Databases and archives Agrotis trux's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF16 396 records

Environmental DNA1 datasets · 8 countries77 detections

DNA & barcodingBOLD78 specimens

01Narrative

Agrotis trux, the crescent dart, is a moth of the family Noctuidae. The species was first described by Jacob Hübner in 1824. It has a circum-Mediterranean distribution and is found along the coasts of France, Ireland, England, southern Europe, Algeria, Syria, Iraq, Iran, southern Russia and the Arabian Peninsula. In Africa, it is found as far south as South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis trux has left across the world's sequence archives.

At a glance

DNA specimens78

BINs5

Marker genes1

eDNA detections77

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus76 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

37Gvariable

54Tmostly conserved

79Tmostly conserved

115Tmostly conserved

181Avariable

209Tmostly conserved

214Gmostly conserved

217Cmostly conserved

262Tvariable

268Tvariable

271Cmostly conserved

337Cmostly conserved

346Tmostly conserved

349Avariable

367Amostly conserved

370Amostly conserved

397Cvariable

430Gmostly conserved

451Amostly conserved

460Tvariable

553Cmostly conserved

622Amostly conserved

643Cvariable

ATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTGGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes29

BINs5

Most divergent pair6.1%

EuropeOtherAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis atruxsame genus2.8%Agrotis striatasame genus2.8%Agrotis trifurcasame genus3.5%Agrotis obliquasame genus3.5%Agrotis mundasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 396 records

Wild obs. + sensor13 535

Museum / vouchered1 872

Other989

Origin

Native992

Range

Area of Occupancy AOO10 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 2 086≤1 km 683≤10 km 8 628>10 km 143

11 540 georeferenced · 1 995 without coordinates

Open the mapobservation + sensor13 535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 90≤1 km 21≤10 km 685>10 km 6

802 georeferenced · 1 070 without coordinates

Open the institutions mapphysical evidence1 872

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	861
UMUlocation not on record	147
Zürich, CH	112
Bern, CH	99
DABUHlocation not on record	50
Fribourg, CH	39
Sion, CH	32
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	30
UGRlocation not on record	27
SFRAlocation not on record	21
Musee d'Histoire Naturallelocation not on record	20
Nijmegen, NL	17
Philadelphia, US	17
Naturmuseum St. Gallenlocation not on record	16
Glarus, CH	15
Durban Natural Science Museumlocation not on record	14
Geneva, CH	14
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	8
Archäologie und Museum Baselland - Museum.BLlocation not on record	7
Tartu, EE	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	7
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	6
Musée de Saint-Imierlocation not on record	4
John May Museum of Natural Historylocation not on record	4
ZSMlocation not on record	4
EGBlocation not on record	3
Auckland, NZ	2
Winterthur, CH	2
Barcelona, ES	1
Provincia di Livornolocation not on record	1
ULLlocation not on record	1
Frauenfeld, CH	1
Bavarian State Collection of Zoologylocation not on record	1
Salzburg, AT	1

35 institutions · 1 599 of 1 872 vouchered records shown · 273 without an institution code

09Environmental DNA77 detections

Where the DNA of Agrotis trux was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map8 countries0

coastal dunesPelouses siliceuses ouest-mediterraneennes (…dunesprivate garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.8–20.8

Seasonal swing summer↔winter15.4 °C

Max temp (day)21.4 °C 18.4–24.4

Min temp (night)12.5 °C 8.00–18.2

Precipitation50.9 mm/mo 33.9–96.7

Air humidity59.4 % 52.7–61.9

Moisture balance-28.9 mm/mo

Vapour deficit768 Pa 640–1,143

Wind speed2.90 m/s

Cloud cover40.3 % 29.1–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis trux

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type16 396 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 396 records