Agrotis obliqua

Smith, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records360

Data sources7

Biological traits0

DNA specimens33

eDNA detections15

Sources7 archives

Databases and archives Agrotis obliqua's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF360 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD33 specimens

01Narrative

Agrotis obliqua is a moth of the family Noctuidae first described by Edgar Albert Smith in 1903. It is found in North America from Newfoundland to Vancouver Island, south to Colorado, Arizona and California. The wingspan is about 30 mm. Adults are on wing in spring and early summer. There is one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis obliqua has left across the world's sequence archives.

At a glance

DNA specimens33

BINs3

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

4Avariable

40Gvariable

55Avariable

56Tvariable

59Tvariable

67Avariable

85Amostly conserved

88Avariable

91Tmostly conserved

121Amostly conserved

127Tmostly conserved

133Amostly conserved

139Tmostly conserved

163Avariable

190Cvariable

202Amostly conserved

205Tmostly conserved

212Tmostly conserved

220Cvariable

223Avariable

229Avariable

235Cvariable

238Tvariable

259Tvariable

266Cmostly conserved

287Cvariable

301Amostly conserved

325Amostly conserved

337Amostly conserved

340Tmostly conserved

367Tvariable

370Amostly conserved

379Tmostly conserved

382Amostly conserved

388Cvariable

401Cmostly conserved

403Tvariable

406Tvariable

427Tvariable

436Tmostly conserved

445Cvariable

463Tvariable

478Tmostly conserved

586Gvariable

589Tmostly conserved

601Cvariable

616Cvariable

619Cvariable

622Gvariable

634Tvariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes4

BINs3

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis anticasame genus1.7%Agrotis buchholzisame genus2.3%Agrotis striatasame genus2.6%Agrotis trifurcasame genus2.7%Agrotis vancouverensissame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type360 records

Wild obs. + sensor42

Museum / vouchered318

Range

Area of Occupancy AOO740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 14≤1 km 13≤10 km 8>10 km 3

38 georeferenced · 4 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 35≤1 km 43≤10 km 35>10 km 4

117 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	108
East Lansing, US	44
Colorado State Universitylocation not on record	33
New Haven, US	26
ASUlocation not on record	14
Oregon State Arthropod Collectionlocation not on record	14
Royal Saskatchewan Museumlocation not on record	12
St. Paul, US	9
Toronto, CA	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Helsinki, FI	7
Cornell University Insect Collectionlocation not on record	4
Vernal, US	3
Mississippi State, US	3
WWUlocation not on record	2
US	2
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

18 institutions · 298 of 318 vouchered records shown · 20 without an institution code

09Environmental DNA15 detections

Where the DNA of Agrotis obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.5–15.8

Seasonal swing summer↔winter31.7 °C

Max temp (day)19.3 °C 14.5–21.1

Min temp (night)9.90 °C 4.50–11.3

Precipitation74.4 mm/mo 39.1–144

Air humidity58.0 % 52.6–61.2

Moisture balance-50.0 mm/mo -80.3–17.2

Vapour deficit739 Pa 530–772

Wind speed3.10 m/s 2.30–4.50

Cloud cover46.4 % 36.5–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)