Agrotis puta

(Hübner, 1803) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records416 702

Data sources8

Biological traits0

DNA specimens115

eDNA detections120

Sources8 archives

Databases and archives Agrotis puta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility416 702 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF416 702 records

Environmental DNA2 datasets · 13 countries120 detections

DNA & barcodingBOLD115 specimens

Genome at a glanceGoaT · NCBI≈522 Mbp

01Narrative

Agrotis puta, aussi connue sous les noms de noctuelle des renouées et élagueuse, est une espèce de Lépidoptères (papillons) de la famille des Noctuidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis puta has left across the world's sequence archives.

At a glance

DNA specimens115

BINs3

Marker genes1

eDNA detections120

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus111 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

646Cmostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes13

BINs3

Most divergent pair4.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis desertorumsame genus3.2%Agrotis ripaesame genus3.3%Agrotis alexandriensissame genus3.4%Agrotis venerabilissame genus3.5%Agrotis daedalussame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrotis puta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈522 118 748 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrotis puta0.52 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.9% BUSCO

08Occurrence & distribution

Record type416 702 records

Wild obs. + sensor408 428

Museum / vouchered7 733

Other541

Origin

Native668

Range

Area of Occupancy AOO66 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 37 097≤1 km 4 382≤10 km 355 158>10 km 509

397 146 georeferenced · 11 282 without coordinates

Open the mapobservation + sensor408 428

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 4 084≤1 km 536≤10 km 2 181>10 km 20

6 821 georeferenced · 912 without coordinates

Open the institutions mapphysical evidence7 733

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	6 424
UMUlocation not on record	344
Helsinki, FI	334
Zürich, CH	144
DABUHlocation not on record	73
Natural History Museum Rotterdamlocation not on record	49
Nijmegen, NL	24
Tartu, EE	23
Podgorica, ME	21
CBDClocation not on record	18
MZLUlocation not on record	17
Durban Natural Science Museumlocation not on record	15
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	12
John May Museum of Natural Historylocation not on record	12
Brussels, BE	10
Glarus, CH	10
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
SFRAlocation not on record	9
Provincia di Livornolocation not on record	9
Naturmuseum Oltenlocation not on record	9
NCMGlocation not on record	8
ZSMlocation not on record	8
Frauenfeld, CH	8
Radicondoli, IT	7
SLU Artdatabankenlocation not on record	5
Auckland, NZ	4
Winterthur, CH	4
Ugentlocation not on record	4
UGRlocation not on record	4
Bern, CH	3
South Kensington, GB	3
Natural History Museum, Londonlocation not on record	2
Geneva, CH	2
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Salzburg, AT	2
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Naturmuseum St. Gallenlocation not on record	1
Research Collection of Bernard Dardennelocation not on record	1

38 institutions · 7 636 of 7 733 vouchered records shown · 97 without an institution code

09Environmental DNA120 detections

Where the DNA of Agrotis puta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys2

Countries13

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map13 countries0

private gardenPrivate gardeninside forestriverinegarden/forest edge/olive field/meadowGarriga

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 8.70–18.4

Seasonal swing summer↔winter15.4 °C

Max temp (day)17.2 °C 12.2–22.1

Min temp (night)9.70 °C 4.20–14.6

Precipitation61.6 mm/mo 31.9–107

Air humidity59.7 % 54.8–62.8

Moisture balance-31.8 mm/mo -81.6–26.2

Vapour deficit673 Pa 436–890

Wind speed3.60 m/s 2.70–5.00

Cloud cover39.9 % 33.3–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 107 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis puta

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type416 702 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type416 702 records