Agrochola pulchella

Smith, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrochola

At a glance

Occurrence records116

Data sources5

Biological traits0

DNA specimens5

eDNA detections5

Sources5 archives

Databases and archives Agrochola pulchella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agrochola pulchella is a species of cutworm or dart moth in the family Noctuidae. The MONA or Hodges number for Agrochola pulchella is 9955.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrochola pulchella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

13Cvariable

22Amostly conserved

31Tvariable

43Avariable

88Tvariable

166Gvariable

238Tvariable

250Cvariable

271Tvariable

274Tvariable

278Tvariable

283Avariable

316Avariable

358Tvariable

442Cvariable

451Tvariable

601Tvariable

604Amostly conserved

616Cvariable

653Tmostly conserved

AACATTATATTTCATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BINs2

Most divergent pair2.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrochola purpureasame genus4.0%Conistra aliciasame family5.6%Eremohadena immundasame family5.8%Agrochola lychnidissame genus6.1%Lithophane ornitopussame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor35

Museum / vouchered81

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 16≤1 km 10≤10 km 1>10 km 1

28 georeferenced · 7 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 7≤1 km 1≤10 km 1

9 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	56
Vernal, US	10
New Haven, US	7
University of Alberta Museums (UAM)location not on record	4
St. Paul, US	1
Essig Museum of Entomologylocation not on record	1
East Lansing, US	1

7 institutions · 80 of 81 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrochola pulchella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 10.9–13.9

Seasonal swing summer↔winter24.1 °C

Max temp (day)15.4 °C 15.4–20.2

Min temp (night)6.70 °C 6.70–8.90

Precipitation99.2 mm/mo 41.0–99.2

Air humidity60.0 % 55.7–60.0

Moisture balance54.4 mm/mo -33.0–54.4

Vapour deficit522 Pa 522–714

Wind speed1.10 m/s 1.10–1.70

Cloud cover56.1 % 41.5–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)