Agrochola purpurea

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrochola

At a glance

Occurrence records438

Data sources5

Biological traits0

DNA specimens29

eDNA detections28

Sources5 archives

Databases and archives Agrochola purpurea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility438 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF438 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD29 specimens

01Narrative

Agrochola purpurea is a species of cutworm or dart moth in the family Noctuidae. The MONA or Hodges number for Agrochola purpurea is 9954.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrochola purpurea has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

313Tmostly conserved

400Cmostly conserved

502Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes10

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrochola pulchellasame genus4.0%Lithophane patefactasame family4.7%Lithophane signosasame family5.0%Lithophane petulcasame family5.0%Lithophane innominatasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type438 records

Wild obs. + sensor97

Museum / vouchered341

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 47≤1 km 16≤10 km 16>10 km 3

82 georeferenced · 15 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 55≤1 km 33≤10 km 52>10 km 2

142 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence341

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	70
Vernal, US	51
Oregon State Arthropod Collectionlocation not on record	51
University of Alberta Museums (UAM)location not on record	47
New Haven, US	45
San Diego, US	24
Mississippi State, US	14
Essig Museum of Entomologylocation not on record	10
Santa Cruz, US	7
St. Paul, US	6
WWUlocation not on record	5
East Lansing, US	3
National Institute of Biological Resourceslocation not on record	2
San Francisco, US	1

14 institutions · 336 of 341 vouchered records shown · 5 without an institution code

09Environmental DNA28 detections

Where the DNA of Agrochola purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 8.90–16.8

Seasonal swing summer↔winter10.0 °C

Max temp (day)20.7 °C 15.0–23.1

Min temp (night)9.00 °C 4.40–11.2

Precipitation38.4 mm/mo 21.1–76.7

Air humidity57.0 % 48.1–60.7

Moisture balance-52.2 mm/mo -87.1–15.5

Vapour deficit701 Pa 527–973

Wind speed2.30 m/s 1.70–3.30

Cloud cover34.9 % 30.0–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)