Agriphila straminella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records95 744

Data sources9

Biological traits0

DNA specimens316

eDNA detections282

Sources9 archives

Databases and archives Agriphila straminella's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI282 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics316 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 744 records

Environmental DNA1 datasets · 17 countries282 detections

DNA & barcodingBOLD316 specimens

Genome at a glanceGoaT · NCBI≈511 Mbp

01Narrative

Agriphila straminella on Achillea Agriphila straminella is a species of moth of the family Crambidae. It was described by Michael Denis and Ignaz Schiffermüller in 1775 and is found in Europe and east across the Palearctic. The wingspan is 16–20 mm. The forewings are brown ; a whitish median streak, ending in branches along veins 2-5, often separated by dark fuscous scales ; dorsal 2/3 often wholly suffused with whitish-ochreous ; a terminal series of black dots ; cilia metallic. Hindwings are rather dark grey. The larva is pale pinkish-ochreous ; spots brown ; head and plate of 2 brown, darker-markedMeyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from June to September depending on the location. The larvae feed on various grasses, such as sheep's fescue (Festuca ovina), smooth meadowgrass (Poa pratensis), and wheat (Triticum aestivum).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding316 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila straminella has left across the world's sequence archives.

At a glance

DNA specimens316

BINs2

Marker genes1

eDNA detections282

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus299 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

38Amostly conserved

44Cmostly conserved

79Tmostly conserved

80Cmostly conserved

123Amostly conserved

200Cmostly conserved

215Amostly conserved

218Amostly conserved

257Tmostly conserved

263Amostly conserved

272Tmostly conserved

293Tmostly conserved

302Cmostly conserved

359Cmostly conserved

389Cmostly conserved

398Amostly conserved

443Tmostly conserved

464Amostly conserved

474Gmostly conserved

475Gmostly conserved

527Tmostly conserved

560Cmostly conserved

587Tmostly conserved

617Tmostly conserved

626Tmostly conserved

644Cmostly conserved

CTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCCCTAAGATTACTAATTCGTGCTGAATTAGGAATCCCCGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes37

BINs2

Most divergent pair4.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila plumbifimbriellussame genus5.2%Agriphila ruricolellussame genus5.7%Agriphila latistriasame genus6.6%Catoptria spatulelloidessame family6.9%Catoptria permutatellussame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agriphila straminella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈511 463 620 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agriphila straminella0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type95 744 records

Wild obs. + sensor91 170

Museum / vouchered4 157

Cultivated / captive1

Other416

Origin

Native333

Introduced1

Range

Area of Occupancy AOO64 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 28 490≤1 km 9 806≤10 km 44 012>10 km 255

82 563 georeferenced · 8 607 without coordinates

Open the mapobservation + sensor91 170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 1 872≤1 km 949≤10 km 663>10 km 395

3 879 georeferenced · 278 without coordinates

Open the institutions mapphysical evidence4 157

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	998
DanishLepidopterologicalSocietylocation not on record	774
Provincia di Livornolocation not on record	272
NHMOlocation not on record	209
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	203
NTNU-VMlocation not on record	171
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	122
Zürich, CH	69
Tartu, EE	61
SLU Artdatabankenlocation not on record	51
RMZlocation not on record	48
Salzburg, AT	42
Kuopio, FI	33
Natural History Museum Rotterdamlocation not on record	26
Stockholm, SE	26
Philadelphia, US	23
Nijmegen, NL	22
Rovaniemi, FI	19
European Distributed Institute of Taxonomy (EDIT)location not on record	18
CBDClocation not on record	15
DABUHlocation not on record	13
Metsähallituslocation not on record	11
Tallinn, EE	8
Tromsø, NO	8
neflocation not on record	6
South Kensington, GB	4
Natural History Museum, Londonlocation not on record	2
NMBU:MINAlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
ZSMlocation not on record	1
University of Kaiserslauternlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Brussels, BE	1
St. Paul, US	1

36 institutions · 3 264 of 4 157 vouchered records shown · 893 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA282 detections

Where the DNA of Agriphila straminella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found282

Studies independent surveys1

Countries17

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 282 detections have coordinates

Open the map17 countries0

Garden, coast and birch habitatFarmland, coast and birch habitat14. Artificial - Terrestrial | 14.5 Urban Ar…Garden and heatland, coastal habitatUrbanForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 10.0–18.7

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.1 °C 13.0–23.0

Min temp (night)11.1 °C 6.30–14.2

Precipitation73.5 mm/mo 54.2–126

Air humidity62.5 % 58.3–65.0

Moisture balance16.0 mm/mo

Vapour deficit672 Pa 482–903

Wind speed4.90 m/s

Cloud cover50.2 % 33.3–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 279 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila straminella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type95 744 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type95 744 records