Agriphila latistria

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records3 139

Data sources7

Biological traits0

DNA specimens21

eDNA detections18

Sources7 archives

Databases and archives Agriphila latistria's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 139 records

Environmental DNA1 datasets · 7 countries18 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agriphila latistria is a species of moth of the family Crambidae. It is found in Europe, but originates from the area surrounding the Mediterranean Sea. Fig.12 case of sand The wingspan is 22–27 mm. The face has a strong sharp cone. Forewings light are ferruginous-brown tinged with grey ; a shining white evenly broad median streak from base to termen, edged with dark fuscous scales ; some blackish terminal dots:cilia shining fuscous, opposite median streak white. Hindwings are pale ochreous-grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from July to September depending on the location. The larvae feed on various grasses, especially Bromus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila latistria has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections18

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

40Gvariable

49Tmostly conserved

70Amostly conserved

88Tmostly conserved

101Gmostly conserved

214Amostly conserved

235Tvariable

250Tvariable

268Amostly conserved

271Avariable

313Tvariable

368Gmostly conserved

430Tvariable

445Tmostly conserved

457Tvariable

478Avariable

484Cvariable

500Cvariable

506Gmostly conserved

542Tvariable

565Amostly conserved

646Cmostly conserved

658Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTGGGAACATCTCTAAGATTATTAATTCGTGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes8

BINs3

Most divergent pair3.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila tollisame genus4.7%Agriphila geniculeasame genus4.9%Catoptria staudingerisame family5.5%Agriphila dalmatinellussame genus5.6%Catoptria lythargyrellasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 139 records

Wild obs. + sensor2 899

Museum / vouchered240

Origin

Native11

Range

Area of Occupancy AOO4 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 326≤1 km 212≤10 km 2 200>10 km 11

2 749 georeferenced · 150 without coordinates

Open the mapobservation + sensor2 899

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 117≤1 km 36≤10 km 55

208 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence240

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	186
Nijmegen, NL	20
Natural History Museum Rotterdamlocation not on record	13
NHMOlocation not on record	8
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
University of Kaiserslauternlocation not on record	2
Zürich, CH	1
neflocation not on record	1
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1
Natural History Museum, Londonlocation not on record	1

11 institutions · 236 of 240 vouchered records shown · 4 without an institution code

09Environmental DNA18 detections

Where the DNA of Agriphila latistria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.9–18.1

Seasonal swing summer↔winter15.9 °C

Max temp (day)19.2 °C 14.9–22.2

Min temp (night)11.9 °C 8.30–14.7

Precipitation55.1 mm/mo 29.4–122

Air humidity58.8 % 45.2–63.2

Moisture balance-50.5 mm/mo -122–21.3

Vapour deficit804 Pa 533–938

Wind speed4.30 m/s 2.20–9.80

Cloud cover37.9 % 19.4–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila latistria

At a glance

Sources7 archives

At a glance

Record type3 139 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 139 records