Agriphila ruricolellus

Zeller, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records2 112

Data sources6

Biological traits0

DNA specimens541

eDNA detections550

Sources6 archives

Databases and archives Agriphila ruricolellus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI550 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics541 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 112 records

Environmental DNA1 datasets · 2 countries550 detections

DNA & barcodingBOLD541 specimens

01Narrative

Agriphila ruricolellus is een vlinder uit de familie van de grasmotten (Crambidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1863 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding541 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila ruricolellus has left across the world's sequence archives.

At a glance

DNA specimens541

BINs3

Marker genes1

eDNA detections550

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus497 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

58Amostly conserved

287Cmostly conserved

478Amostly conserved

520Gmostly conserved

541Tmostly conserved

616Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCCTAAGATTACTAATTCGTGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 45 variants.

Diversity (π)1.1%

Haplotypes45

BINs3

Most divergent pair2.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila plumbifimbriellussame genus5.4%Agriphila straminellasame genus5.7%Agriphila dalmatinellussame genus7.1%Agriphila latistriasame genus7.2%Catoptria staudingerisame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 112 records

Wild obs. + sensor982

Museum / vouchered1 130

Range

Area of Occupancy AOO3 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 510≤1 km 161≤10 km 35>10 km 86

792 georeferenced · 190 without coordinates

Open the mapobservation + sensor982

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 41≤10 km 84>10 km 28

154 georeferenced · 976 without coordinates

Open the institutions mapphysical evidence1 130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	281
University of Alberta Museums (UAM)location not on record	267
East Lansing, US	82
New Haven, US	48
Mississippi State, US	40
Philadelphia, US	29
Cornell University Insect Collectionlocation not on record	27
Vernal, US	26
Royal Saskatchewan Museumlocation not on record	21
St. Paul, US	7
Centre for Biodiversity Genomicslocation not on record	3
Cambridge, US	2
Washington, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
SOVTlocation not on record	1
Blacksburg, US	1
Saint John, CA	1

17 institutions · 838 of 1 130 vouchered records shown · 292 without an institution code

09Environmental DNA550 detections

Where the DNA of Agriphila ruricolellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found550

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 550 detections have coordinates

Open the map2 countries0

Agricultural1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest14. Artificial - Terrestrial|14.1 Arable LandMixed Habitat4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 14.2–20.4

Seasonal swing summer↔winter27.3 °C

Max temp (day)23.1 °C 18.8–25.2

Min temp (night)15.5 °C 8.80–18.4

Precipitation82.6 mm/mo 55.6–107

Air humidity59.8 % 54.0–70.6

Moisture balance-41.6 mm/mo

Vapour deficit907 Pa 606–955

Wind speed3.30 m/s

Cloud cover40.0 % 34.8–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 541 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila ruricolellus

At a glance

Sources6 archives

At a glance

Record type2 112 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 112 records