Agriotes stabilis

(LeConte, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Agriotes

At a glance

Occurrence records139

Data sources6

Biological traits0

DNA specimens50

eDNA detections47

Sources6 archives

Databases and archives Agriotes stabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 1 countries47 detections

DNA & barcodingBOLD50 specimens

01Narrative

Agriotes stabilis is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriotes stabilis has left across the world's sequence archives.

At a glance

DNA specimens50

BINs1

Marker genes1

eDNA detections47

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

37Gvariable

217Cmostly conserved

364Cvariable

595Tmostly conserved

601Cmostly conserved

TACCCTATACTTCATTTTTGGTGCTTGAGCAGGAATGCTAGGAACATCATTAAGACTTCTAATTCGAGCTGAGCTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes7

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriotes quebecensissame genus7.1%Agriotes ferrugineipennissame genus7.9%Dolerosomus silaceussame family11.7%Agriotes limosussame genus12.2%Agriotes thevenetiisame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor14

Museum / vouchered125

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 5

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 1≤10 km 10

11 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	30
University of Guelphlocation not on record	23
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
Espace pour la vielocation not on record	7
Saint John, CA	7
Royal Saskatchewan Museumlocation not on record	7
University Park, US	2
East Lansing, US	2
Lexington, US	2

9 institutions · 89 of 125 vouchered records shown · 36 without an institution code

09Environmental DNA47 detections

Where the DNA of Agriotes stabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map1 country0

1. Forest & WoodlandForestforest understoryforest canopy

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 10.9–18.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)20.2 °C 15.1–23.1

Min temp (night)11.5 °C 6.50–14.8

Precipitation115 mm/mo 89.2–121

Air humidity60.1 % 58.4–62.3

Moisture balance3.00 mm/mo

Vapour deficit680 Pa 520–855

Wind speed2.50 m/s

Cloud cover47.7 % 42.8–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)