Agriotes limosus

(LeConte, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Agriotes

At a glance

Occurrence records114

Data sources5

Biological traits0

DNA specimens41

eDNA detections37

Sources5 archives

Databases and archives Agriotes limosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF114 records

Environmental DNA1 datasets · 1 countries37 detections

DNA & barcodingBOLD41 specimens

01Narrative

Agriotes limosus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriotes limosus has left across the world's sequence archives.

At a glance

DNA specimens41

BINs3

Marker genes1

eDNA detections37

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

3Cmostly conserved

141Cmostly conserved

180Gmostly conserved

219Cmostly conserved

237Tmostly conserved

339Cmostly conserved

414Tmostly conserved

630Gvariable

636Amostly conserved

ACCCTATATTTCATTTTTGGTGCTTGAGCAGGAATGCTAGGAACATCATTAAGATTACTAATTCGTGCTGAATTAGGTAACCCTGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes5

BINs2

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriotes tardussame genus6.3%Ectinus aterrimussame family11.3%Agriotes avulsussame genus11.7%Agriotes fucosussame genus11.7%Agriotes brevissame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type114 records

Wild obs. + sensor8

Museum / vouchered106

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 4≤1 km 1>10 km 3

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤1 km 6≤10 km 7>10 km 4

17 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Espace pour la vielocation not on record	14
Saint John, CA	9
McGill Universitylocation not on record	7
University of Guelphlocation not on record	5
University Park, US	3
McGill University, Lyman Entomological Museumlocation not on record	1
Canadian Forest Service, Northern Forestry Centrelocation not on record	1

9 institutions · 84 of 106 vouchered records shown · 22 without an institution code

09Environmental DNA37 detections

Where the DNA of Agriotes limosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map1 country0

Mixed habitatWetlandMesic1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–15.9

Seasonal swing summer↔winter22.8 °C

Max temp (day)16.1 °C 11.2–19.4

Min temp (night)8.50 °C 4.10–12.1

Precipitation101 mm/mo 99.6–126

Air humidity62.8 % 58.0–63.6

Moisture balance-2.50 mm/mo -15.5–11.6

Vapour deficit520 Pa 396–779

Wind speed3.60 m/s 2.40–3.70

Cloud cover55.8 % 48.2–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)