Agriotes fucosus

(LeConte, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Agriotes

At a glance

Occurrence records410

Data sources6

Biological traits0

DNA specimens150

eDNA detections155

Sources6 archives

Databases and archives Agriotes fucosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI155 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics150 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF410 records

Environmental DNA2 datasets · 2 countries155 detections

DNA & barcodingBOLD150 specimens

01Narrative

Agriotes fucosus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding150 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriotes fucosus has left across the world's sequence archives.

At a glance

DNA specimens150

BINs1

Marker genes1

eDNA detections155

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus139 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

225Tvariable

234Tmostly conserved

270Cmostly conserved

339Cmostly conserved

399Avariable

495Gmostly conserved

594Tmostly conserved

633Tmostly conserved

ACGCTATACTTTATTTTTGGTGCCTGGGCAGGAATGCTTGGAACATCACTAAGACTTCTAATTCGTGCTGAATTAGGTAACCCTGGCTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes21

BIN1

Most divergent pair2.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ectinus aterrimussame family8.3%Agriotes limosussame genus11.7%Agriotes tardussame genus12.1%Agriotes ferrugineipennissame genus12.6%Agriotes oguraesame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type410 records

Wild obs. + sensor97

Museum / vouchered313

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 58≤1 km 10≤10 km 10>10 km 8

86 georeferenced · 11 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 4≤10 km 4>10 km 2

10 georeferenced · 303 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	91
Royal Saskatchewan Museumlocation not on record	28
University of Guelphlocation not on record	27
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	22
Saint John, CA	14
Espace pour la vielocation not on record	5
Champaign, US	2
Cambridge, US	1
Lexington, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
East Lansing, US	1
University Park, US	1

12 institutions · 194 of 313 vouchered records shown · 119 without an institution code

09Environmental DNA155 detections

Where the DNA of Agriotes fucosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found155

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 155 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForest, Old fieldfarmOld fieldforest understoryforest canopy

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 8.00–17.0

Seasonal swing summer↔winter24.2 °C

Max temp (day)16.4 °C 10.7–21.8

Min temp (night)10.4 °C 5.20–15.0

Precipitation96.6 mm/mo 86.4–121

Air humidity63.1 % 55.9–74.6

Moisture balance21.7 mm/mo

Vapour deficit489 Pa 364–807

Wind speed5.00 m/s

Cloud cover44.2 % 42.1–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 153 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)