Agriotes ferrugineipennis

(LeConte, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Agriotes

At a glance

Occurrence records41

Data sources7

Biological traits0

DNA specimens14

eDNA detections9

Sources7 archives

Databases and archives Agriotes ferrugineipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · NCBI≈1.3 Gbp

01Narrative

Agriotes ferrugineipennis is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1861 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriotes ferrugineipennis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

252Tmostly conserved

531Amostly conserved

553Gmostly conserved

ATTTTTGGTGCTTGAGCAGGAATGCTAGGAACATCACTAAGACTCCTAATTCGAGCTGAGCTAGGTAACCCAGGATCACTTATCGGAAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriotes stabilissame genus7.9%Agriotes quebecensissame genus8.8%Agriotes opaculussame genus11.0%Agriotes limosussame genus12.3%Ectinus sericeussame family12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agriotes ferrugineipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 267 921 477 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agriotes ferrugineipennis1.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type41 records

Wild obs. + sensor30

Museum / vouchered11

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 12≤1 km 8≤10 km 2

22 georeferenced · 8 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Scott Gilmore Collectionlocation not on record	3
ASUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
California Academy of Scienceslocation not on record	1
University Park, US	1
Champaign, US	1

6 institutions · 9 of 11 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Agriotes ferrugineipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Base of TreesBog Forest, Cedar-Salal Forest, Zonal Forestsand dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 2.90–13.4

Seasonal swing summer↔winter19.2 °C

Max temp (day)13.7 °C 7.50–17.3

Min temp (night)6.10 °C -2.90–10.2

Precipitation51.0 mm/mo 39.1–194

Air humidity58.3 % 56.3–65.0

Moisture balance-41.3 mm/mo -72.5–88.2

Vapour deficit495 Pa 328–638

Wind speed2.30 m/s 1.50–4.90

Cloud cover43.0 % 38.2–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)