Agrilus smaragdifrons

Ganglbauer, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records46

Data sources7

Biological traits0

DNA specimens10

eDNA detections1

Sources7 archives

Databases and archives Agrilus smaragdifrons's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF46 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Agrilus smaragdifrons é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Ganglbauer, 1890.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus smaragdifrons has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

34Tvariable

50Cmostly conserved

52Amostly conserved

88Avariable

143Gmostly conserved

145Tmostly conserved

250Tmostly conserved

262Avariable

271Cmostly conserved

287Cmostly conserved

307Avariable

316Gmostly conserved

400Tvariable

412Cvariable

415Amostly conserved

448Tvariable

478Gvariable

529Avariable

547Tmostly conserved

548Cvariable

559Gmostly conserved

574Cvariable

596Tmostly conserved

616Cmostly conserved

625Avariable

631Avariable

GACACTTTATTTTATTTTTGGGGCCTGATCGGGTATAGTAGGAACTGCTCTAAGACTTTTAATCCGAGCCGAACTCGGGAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs3

Most divergent pair3.3%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus planipennissame genus16.3%Agrilus auropictussame genus16.3%Melobasis vittatasame family16.6%Agrilus ribbeisame genus16.7%Eupleurus subterraneussame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor45

Museum / vouchered1

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 21≤1 km 6≤10 km 2>10 km 3

32 georeferenced · 13 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Agrilus smaragdifrons was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter29.4 °C

Max temp (day)19.1 °C

Min temp (night)8.90 °C

Precipitation22.4 mm/mo

Air humidity48.5 %

Moisture balance-107 mm/mo

Vapour deficit845 Pa

Wind speed5.20 m/s

Cloud cover32.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)