Agrilus planipennis

Fairmaire, 1888 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records4 579

Data sources9

Biological traits0

DNA specimens85

eDNA detections82

Sources9 archives

Databases and archives Agrilus planipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics85 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 579 records

Environmental DNA1 datasets · 3 countries82 detections

DNA & barcodingBOLD85 specimens

Genome at a glanceGoaT · NCBI≈353 Mbp

01Narrative

L'agrile du frêne est une espèce d'insectes coléoptères de la famille des Buprestidae, originaire d'Asie orientale tempérée. Il se caractérise par une coloration vert métallique au stade adulte. Comme l'indique son nom vernaculaire, il réalise son cycle vital sur plusieurs espèces de frênes. Il a été introduit accidentellement en Amérique du Nord où il s'est répandu dans la majeure partie des forêts tempérées de l'Est, ravageant les espèces autochtones de frênes désormais gravement menacées, ce qui en fait une espèce exotique envahissante. Il a aussi été introduit en Europe de l'Est dans la région de Moscou et progresse actuellement vers l'Ouest, menaçant les frênes européens. Cet insecte lignicole est un foreur du bois. Les larves vivent sous l’écorce des frênes et en consomment le phloème. Les larves forment ainsi plusieurs galeries d’alimentation qui finissent par couper le système de transport des éléments nutritifs et de l'eau de l’arbre. C’est seulement après deux ou trois ans d'infestation continue, que la population augmente et qu’il est ainsi possible de réellement détecter l’infestation; peu de symptômes sont présents avant cela. Les infestations peuvent causer des dommages importants aux frênes et souvent la mort des arbres infestés.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding85 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus planipennis has left across the world's sequence archives.

At a glance

DNA specimens85

BINs1

Marker genes3

eDNA detections82

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes1

BIN1

ACACTCTACTTTATTTTTGGGGCCTGATCAGGAATAGTAGGAACAGCCCTTAGACTACTAATTCGAGCAGAATTAGGAAATCCAGGAGCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus blatteicollissame genus15.2%Agonum propinquumsame order16.1%Agrilus smaragdifronssame genus16.3%Agonum corvussame order16.7%Agonum versutumsame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_030758 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND5ND4ND4LND6CYTBND1ND2COX1COX2ATP8ATP6COX3ND3rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrilus planipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈353 056 831 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrilus planipennis0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.6% BUSCO

08Occurrence & distribution

Record type4 579 records

Wild obs. + sensor4 106

Museum / vouchered473

Range

Area of Occupancy AOO12 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 2 411≤1 km 551≤10 km 137>10 km 257

3 356 georeferenced · 750 without coordinates

Open the mapobservation + sensor4 106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 55≤10 km 28>10 km 1

88 georeferenced · 385 without coordinates

Open the institutions mapphysical evidence473

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	213
St. Paul, US	82
ASUlocation not on record	33
SOVTlocation not on record	18
UDlocation not on record	12
Cornell University Insect Collectionlocation not on record	11
Chicago, US	10
Champaign, US	10
Lubbock, US	7
New Haven, US	6
OSUClocation not on record	6
Toronto, CA	6
EJCBlocation not on record	6
WIlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University Park, US	3
Decorah, US	2
CUlocation not on record	1
Research Collection of Tim Myleslocation not on record	1
San Francisco, US	1
Mississippi State, US	1
Paris, FR	1
Zoological Institute, Russian Academy of Scienceslocation not on record	1
Helsinki, FI	1
Lake Placid, US	1
Centre for Biodiversity Genomicslocation not on record	1
BUJClocation not on record	1
Wuzhou, CN	1
US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	1
Saint John, CA	1

32 institutions · 447 of 473 vouchered records shown · 25 without an institution code

09Environmental DNA82 detections

Where the DNA of Agrilus planipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map3 countries0

Black ash logsMixed habitatForest3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.40 °C -6.50–21.5

Seasonal swing summer↔winter30.5 °C

Max temp (day)10.6 °C -2.30–26.1

Min temp (night)2.20 °C -11.0–17.3

Precipitation64.8 mm/mo 44.5–97.9

Air humidity59.0 % 57.4–62.8

Moisture balance5.80 mm/mo -64.8–36.6

Vapour deficit367 Pa 141–1,079

Wind speed3.40 m/s 3.20–4.30

Cloud cover53.8 % 39.4–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrilus planipennis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 579 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 579 records