Agrilus ruficollis

(Fabricius, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records2 044

Data sources8

Biological traits0

DNA specimens14

eDNA detections13

Sources8 archives

Databases and archives Agrilus ruficollis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 044 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 044 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Agrilus ruficollis, the red-necked cane borer, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Europe and Northern Asia (excluding China) and North America. Red-necked cane borer, Agrilus ruficollis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus ruficollis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair2.0%

Where individuals differ — all 15 variable positions, in barcode order

10Cvariable

22Gvariable

43Avariable

58Gmostly conserved

70Avariable

97Cvariable

190Gvariable

196Gvariable

217Avariable

250Cmostly conserved

373Gmostly conserved

562Gmostly conserved

565Amostly conserved

596Tmostly conserved

655Gmostly conserved

GACTTTATACTTTATTTTTGGGGCATGATCGGGAGTTGTGGGAACTGCTCTTAGATTGTTAATCCGGGCAGAATTAGGAAACCCGGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus criddleisame genus14.1%Agrilus atersame genus14.4%Agrilus carpinisame genus14.4%Agrilus anxiussame genus14.6%Agrilus vittaticollissame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 044 records

Wild obs. + sensor1 807

Museum / vouchered237

Range

Area of Occupancy AOO5 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 846≤1 km 318≤10 km 67>10 km 219

1 450 georeferenced · 357 without coordinates

Open the mapobservation + sensor1 807

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 20≤10 km 65>10 km 31

117 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	75
Lexington, US	41
University Park, US	33
ASUlocation not on record	16
University of Central Floridalocation not on record	15
Lubbock, US	13
WIlocation not on record	8
Denver, US	5
US	5
OSUClocation not on record	4
College Station, US	3
UDlocation not on record	3
SOVTlocation not on record	2
CUlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Natural History Museum of Utahlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Saint John, CA	1
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	1
University of Vermontlocation not on record	1
Champaign, US	1

21 institutions · 231 of 237 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Agrilus ruficollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C -4.40–21.0

Seasonal swing summer↔winter31.0 °C

Max temp (day)23.8 °C -1.10–25.5

Min temp (night)14.2 °C -6.50–16.6

Precipitation103 mm/mo 54.0–115

Air humidity57.9 % 57.4–65.1

Moisture balance-40.0 mm/mo -45.8–-1.40

Vapour deficit918 Pa 269–1,056

Wind speed3.60 m/s 2.70–5.60

Cloud cover45.5 % 44.5–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrilus ruficollis

At a glance

Sources8 archives

At a glance

Record type2 044 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 044 records