Agrilus ater

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records987

Data sources6

Biological traits0

DNA specimens8

eDNA detections8

Sources6 archives

Databases and archives Agrilus ater's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility987 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF987 records

Environmental DNA1 datasets · 6 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

De populierenprachtkever is een keversoort uit de familie prachtkevers (Buprestidae). De slanke kever is tussen de zes en elf millimeter lang. Hij heeft een donkere metaalgloed en is makkelijk te herkennen aan de drie witte vlekken op elk dekschild (elytrum). De populierenprachtkever komt in een groot deel van Europa voor. De larven ontwikkelen zich in de schors van populieren en wilgen. De volwassen kevers zijn ook op deze bomen te vinden. In Centraal-Europa zijn ze met name in juni en juli actief. In 1767 werd de wetenschappelijke naam door Carl Linnaeus gepubliceerd als Buprestis ater. Hij beschreef de kever als corpore atro enlongato. Hieraan ontleent de kever de soortnaam āter, wat 'zwart' betekent.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus ater has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

43Amostly conserved

88Cvariable

133Gmostly conserved

349Gvariable

373Avariable

492Gmostly conserved

GACCTTATATTTTATTTTTGGAGCTTGATCTGGTCTTGTAGGAACCGCACTTAGATTACTAATCCGAGCAGAATTAGGCAACCCAGGCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes4

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pensussame genus12.0%Agrilus anxiussame genus12.6%Agrilus criddleisame genus12.8%Agrilus vittaticollissame genus12.8%Agrilus carpinisame genus13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type987 records

Wild obs. + sensor752

Museum / vouchered203

Other32

Origin

Native88

Range

Area of Occupancy AOO1 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 157≤1 km 41≤10 km 433>10 km 8

639 georeferenced · 113 without coordinates

Open the mapobservation + sensor752

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 5≤1 km 33≤10 km 73>10 km 9

120 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tallinn, EE	27
Muzeum Górnośląskie w Bytomiulocation not on record	22
Helsinki, FI	21
Zürich, CH	18
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	14
EJCBlocation not on record	12
IFR-DNFlocation not on record	11
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Tartu, EE	5
Provincia di Livornolocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Musee d'Histoire Naturallelocation not on record	4
Geneva, CH	2
Metsähallituslocation not on record	2
Tilburg, NL	2
MZLUlocation not on record	2
Paro, BT	1
ZSMlocation not on record	1
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
SLU Artdatabankenlocation not on record	1

21 institutions · 163 of 203 vouchered records shown · 40 without an institution code

09Environmental DNA8 detections

Where the DNA of Agrilus ater was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map6 countries0

Forestmeadow at riverside

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 12.6–19.6

Seasonal swing summer↔winter20.8 °C

Max temp (day)21.7 °C 16.4–23.9

Min temp (night)13.0 °C 8.20–14.9

Precipitation67.0 mm/mo 56.5–83.9

Air humidity58.2 % 56.8–61.2

Moisture balance-50.2 mm/mo -68.4–-26.7

Vapour deficit858 Pa 628–981

Wind speed3.10 m/s 2.30–3.50

Cloud cover35.0 % 34.0–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)