Agrilus anxius

Gory, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records684

Data sources10

Biological traits0

DNA specimens33

eDNA detections33

Sources10 archives

Databases and archives Agrilus anxius's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility684 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF684 records

Environmental DNA1 datasets · 1 countries33 detections

DNA & barcodingBOLD33 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Agrilus anxius, the bronze birch borer, is a wood-boring buprestid beetle native to North America, more numerous in warmer parts of the continent and rare in the north. It is a serious pest on birch trees (Betula), frequently killing them. The river birch Betula nigra is the most resistant species, other American birches less so, while the European and Asian birches have no resistance to it at all and are effectively impossible to grow in the eastern United States as a result. It is closely related to the emerald ash borer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus anxius has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections33

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 62 variable positions, in barcode order

40Amostly conserved

61Gmostly conserved

64Tmostly conserved

67Gmostly conserved

74Tmostly conserved

79Gmostly conserved

82Cmostly conserved

85Gmostly conserved

88Gmostly conserved

92Cmostly conserved

103Tmostly conserved

112Tmostly conserved

170Amostly conserved

175Amostly conserved

178Amostly conserved

187Tmostly conserved

197Tmostly conserved

217Cmostly conserved

247Cmostly conserved

262Gmostly conserved

266Tmostly conserved

274Amostly conserved

277Amostly conserved

283Tmostly conserved

286Amostly conserved

289Tmostly conserved

298Amostly conserved

307Amostly conserved

316Tmostly conserved

319Gmostly conserved

322Amostly conserved

325Tmostly conserved

337Tmostly conserved

343Gmostly conserved

355Tmostly conserved

367Cmostly conserved

373Cmostly conserved

406Tmostly conserved

409Amostly conserved

412Tmostly conserved

454Tmostly conserved

472Cmostly conserved

475Tmostly conserved

484Tmostly conserved

499Amostly conserved

518Gmostly conserved

523Tmostly conserved

526Amostly conserved

532Tmostly conserved

535Cmostly conserved

568Tmostly conserved

571Tmostly conserved

581Cmostly conserved

607Tmostly conserved

610Cmostly conserved

619Gmostly conserved

628Cmostly conserved

631Gmostly conserved

637Tmostly conserved

646Tmostly conserved

649Amostly conserved

658Tmostly conserved

AACCTTGTACTTTATTTTTGGGGCTTGATCTGGTATTGTAGGTACCGCACTTAGATTATTGATTCGGGCAGAATTAGGGAACCCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BIN1

Most divergent pair7.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pensussame genus3.5%Agrilus granulatussame genus7.3%Agrilus vittaticollissame genus11.6%Agrilus carpinisame genus12.2%Agrilus coxalissame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agrilus anxius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 226×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Karagyan G, Kuznetsova KG (2000) Chromosome numbers and sex chromosome systems in buprestid beetles (Coleoptera, Buprestidae). Entomological Review 80: 38-49. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type684 records

Wild obs. + sensor33

Museum / vouchered651

Range

Area of Occupancy AOO864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 16≤1 km 12>10 km 1

29 georeferenced · 4 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 1≤10 km 13>10 km 11

25 georeferenced · 626 without coordinates

Open the institutions mapphysical evidence651

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	174
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	160
Vernal, US	89
Chicago, US	61
SOVTlocation not on record	47
WIlocation not on record	28
St. Paul, US	27
University of Alberta Museums (UAM)location not on record	12
Royal Saskatchewan Museumlocation not on record	12
Lexington, US	6
Denver, US	4
University Park, US	4
Universidad Católica de Manizaleslocation not on record	4
ASUlocation not on record	4
University of Central Floridalocation not on record	4
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	3
Lubbock, US	1
OSUClocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	1
Catholic University of Pekinglocation not on record	1
University of Vermontlocation not on record	1

23 institutions · 646 of 651 vouchered records shown · 5 without an institution code

09Environmental DNA33 detections

Where the DNA of Agrilus anxius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.2–19.5

Seasonal swing summer↔winter30.4 °C

Max temp (day)22.2 °C 18.0–24.2

Min temp (night)12.6 °C 7.40–15.3

Precipitation96.4 mm/mo 80.8–135

Air humidity57.8 % 55.4–61.8

Moisture balance-34.9 mm/mo -51.8–24.3

Vapour deficit831 Pa 584–912

Wind speed3.20 m/s 2.50–3.90

Cloud cover46.3 % 40.5–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)