Agrilus granulatus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records123

Data sources8

Biological traits0

DNA specimens42

eDNA detections38

Sources8 archives

Databases and archives Agrilus granulatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF123 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD42 specimens

01Narrative

Agrilus granulatus, the granulate poplar borer, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus granulatus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes2

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

88Gmostly conserved

202Amostly conserved

298Gmostly conserved

307Gmostly conserved

316Gmostly conserved

337Cmostly conserved

346Tmostly conserved

370Tmostly conserved

373Tmostly conserved

412Cmostly conserved

475Amostly conserved

518Amostly conserved

568Gmostly conserved

581Tmostly conserved

628Gmostly conserved

631Amostly conserved

649Gmostly conserved

658Cmostly conserved

AACCTTGTACTTTATTTTTGGGGCTTGATCTGGTATTGTGGGTACCGCACTTAGATTATTAATCCGAGCAGAATTAGGAAATCCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes10

BINs2

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus pensussame genus6.1%Agrilus anxiussame genus7.3%Agrilus criddleisame genus7.8%Agrilus coxalissame genus13.8%Agrilus carpinisame genus14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type123 records

Wild obs. + sensor8

Museum / vouchered115

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 3

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	56
Chicago, US	19
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	13
SOVTlocation not on record	12
University Park, US	6
ASUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
CUlocation not on record	1
Washington, US	1

9 institutions · 111 of 115 vouchered records shown · 2 without an institution code

09Environmental DNA38 detections

Where the DNA of Agrilus granulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

farmRiparian Zone1. Forest & Woodland | 1.1. Boreal ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 11.6–21.0

Seasonal swing summer↔winter30.6 °C

Max temp (day)23.2 °C 18.8–26.1

Min temp (night)13.8 °C 4.90–16.6

Precipitation103 mm/mo 75.0–156

Air humidity59.0 % 57.3–61.0

Moisture balance-39.5 mm/mo -60.7–24.4

Vapour deficit830 Pa 679–1,044

Wind speed2.60 m/s 2.30–3.50

Cloud cover45.0 % 39.7–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)