Agrilus obscuricollis

Kiesenwetter, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records1 173

Data sources9

Biological traits0

DNA specimens10

eDNA detections10

Sources9 archives

Databases and archives Agrilus obscuricollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 173 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Agrilus obscuricollis é uma espécie de inseto do género Agrilus, família Buprestidae, ordem Coleoptera. Foi descrita cientificamente por Kiesenwetter, 1857.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus obscuricollis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections10

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

21Cmostly conserved

48Gmostly conserved

157Gmostly conserved

210Amostly conserved

240Tmostly conserved

300Cvariable

309Gmostly conserved

375Cmostly conserved

429Amostly conserved

459Tmostly conserved

492Amostly conserved

510Amostly conserved

606Gmostly conserved

627Cmostly conserved

CATAAAGACATTGGAACACTCTACTTCATTTTCGGTGCATGATCCGGGATGGTGGGAACTGCTCTAAGATTACTGGTCCGGGCAGAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus laticornissame genus15.4%Agrilus hastulifersame genus16.6%Agrilus olivicolorsame genus16.6%Agrilus adelphinussame genus16.6%Agrilus ribbeisame genus16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agrilus obscuricollis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Karagyan G, Kuznetsova VG, Lachowska D (2004) New cytogenetic data on Armenian buprestids (Coleoptera, Buprestidae) with a discussion of karyotype variation within the family. Folia Biologica-Krakow 52: 151-158. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type1 173 records

Wild obs. + sensor468

Museum / vouchered411

Other294

Origin

Native129

Range

Area of Occupancy AOO1 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 50≤1 km 16≤10 km 355>10 km 7

428 georeferenced · 40 without coordinates

Open the mapobservation + sensor468

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 5≤1 km 30≤10 km 232>10 km 3

270 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	96
Musee d'Histoire Naturallelocation not on record	30
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	27
Geneva, CH	21
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	16
Provincia di Livornolocation not on record	15
Bern, CH	14
IFR-DNFlocation not on record	8
Tallinn, EE	8
Zürich, CH	6
SLU Artdatabankenlocation not on record	3
Fribourg, CH	2
Natural History Museum Rotterdamlocation not on record	2
Naturkundemuseum Erfurtlocation not on record	2
Salzburg, AT	1
Paris, FR	1
Tilburg, NL	1
MZLUlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

19 institutions · 255 of 411 vouchered records shown · 153 without an institution code

09Environmental DNA10 detections

Where the DNA of Agrilus obscuricollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.90 °C 5.90–18.0

Seasonal swing summer↔winter20.5 °C

Max temp (day)9.70 °C 9.70–22.2

Min temp (night)1.10 °C 1.10–12.0

Precipitation82.6 mm/mo 60.1–82.6

Air humidity65.9 % 56.7–65.9

Moisture balance28.8 mm/mo -80.7–28.8

Vapour deficit370 Pa 370–887

Wind speed1.80 m/s 1.80–3.80

Cloud cover43.4 % 32.2–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrilus obscuricollis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 173 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 173 records