Agrilus lecontei

Saunders, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records463

Data sources8

Biological traits0

DNA specimens8

eDNA detections4

Sources8 archives

Databases and archives Agrilus lecontei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD8 specimens

01Narrative

Agrilus lecontei, or Leconte's Brownsville buprestid, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus lecontei has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

1Cvariable

22Gvariable

34Avariable

43Avariable

50Cmostly conserved

56Cmostly conserved

79Tmostly conserved

100Avariable

115Cmostly conserved

124Tmostly conserved

127Amostly conserved

130Cvariable

148Avariable

157Cvariable

184Avariable

196Gmostly conserved

197Tmostly conserved

199Amostly conserved

202Cmostly conserved

217Avariable

250Tmostly conserved

271Cvariable

301Gmostly conserved

304Amostly conserved

313Cvariable

316Amostly conserved

328Gmostly conserved

337Amostly conserved

343Cvariable

364Amostly conserved

373Gmostly conserved

382Gvariable

433Avariable

451Tmostly conserved

466Avariable

475Amostly conserved

478Amostly conserved

485Tmostly conserved

496Amostly conserved

499Cmostly conserved

500Tmostly conserved

503Cvariable

511Gmostly conserved

520Avariable

526Cvariable

550Cvariable

562Gmostly conserved

583Tmostly conserved

595Tmostly conserved

604Tmostly conserved

616Tmostly conserved

622Amostly conserved

625Avariable

634Cvariable

649Avariable

652Cvariable

653Tvariable

CACACTTTACTTTATTTTTGGGGCCTGATCAGGAATAGTAGGAACCGCCCTATCACTATTAATCCGAGCTGAACTTGGTAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes3

BINs3

Most divergent pair7.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus ribbeisame genus15.8%Agrilus adelphinussame genus16.1%Chrysobothris viridiimpressasame family16.6%Merimna atratasame family16.7%Agrilus planipennissame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type463 records

Wild obs. + sensor224

Museum / vouchered239

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 120≤1 km 28≤10 km 4>10 km 24

176 georeferenced · 48 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 1≤1 km 6≤10 km 6>10 km 5

18 georeferenced · 221 without coordinates

Open the institutions mapphysical evidence239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	75
College Station, US	70
Chicago, US	55
Lubbock, US	10
University of Central Floridalocation not on record	6
WIlocation not on record	4
Lexington, US	4
St. Paul, US	4
Wuzhou, CN	3
University Park, US	2
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
MAJClocation not on record	1
ASUlocation not on record	1

14 institutions · 237 of 239 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Agrilus lecontei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.9–21.1

Seasonal swing summer↔winter31.0 °C

Max temp (day)23.0 °C 23.0–24.0

Min temp (night)15.0 °C 15.0–18.9

Precipitation102 mm/mo 96.2–102

Air humidity56.5 % 56.5–57.7

Moisture balance-48.2 mm/mo -87.4–-48.2

Vapour deficit949 Pa 949–1,058

Wind speed3.80 m/s 3.80–5.70

Cloud cover44.9 % 40.3–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)