Agrilus bilineatus

(Weber, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records812

Data sources8

Biological traits0

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Agrilus bilineatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility812 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF812 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Agrilus bilineatus, the two-lined chestnut borer, is a species of metallic wood-boring beetle in the family Buprestidae. It is native to North America, and has been introduced to Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus bilineatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 31 variable positions, in barcode order

10Tvariable

43Cmostly conserved

49Gmostly conserved

67Gmostly conserved

70Tmostly conserved

85Avariable

103Cmostly conserved

190Gmostly conserved

196Gmostly conserved

214Gmostly conserved

232Cmostly conserved

238Cvariable

268Gmostly conserved

283Cmostly conserved

284Cmostly conserved

286Gmostly conserved

317Gmostly conserved

343Cmostly conserved

352Cmostly conserved

355Cmostly conserved

358Tmostly conserved

379Cmostly conserved

427Cvariable

469Gmostly conserved

472Cmostly conserved

475Amostly conserved

514Amostly conserved

518Amostly conserved

526Tmostly conserved

542Cmostly conserved

544Gmostly conserved

AACCTTGTATTTTATTTTTGGGGCTTGATCAGGTGTTGTAGGCACAGCGCTCAGATTATTAATCCGGGCTGAACTAGGAAACCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus carpinisame genus5.0%Agrilus anxiussame genus14.7%Agrilus pensussame genus14.7%Agrilus atersame genus15.0%Agrilus criddleisame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type812 records

Wild obs. + sensor234

Museum / vouchered578

Origin

Native1

Range

Area of Occupancy AOO1 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 99≤1 km 53≤10 km 14>10 km 26

192 georeferenced · 42 without coordinates

Open the mapobservation + sensor234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 1≤1 km 6≤10 km 27>10 km 3

37 georeferenced · 541 without coordinates

Open the institutions mapphysical evidence578

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	193
St. Paul, US	162
Chicago, US	101
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	19
University Park, US	16
SOVTlocation not on record	12
College Station, US	10
Lexington, US	10
OSUClocation not on record	10
University of Central Floridalocation not on record	7
ASUlocation not on record	7
University of Tennessee at Chattanoogalocation not on record	5
Lubbock, US	5
CUlocation not on record	3
Cambridge, US	3
Denver, US	2
WIlocation not on record	1
MAJClocation not on record	1
UDlocation not on record	1
US	1
Wuzhou, CN	1
Philadelphia, US	1
Saint John, CA	1

23 institutions · 572 of 578 vouchered records shown · 3 without an institution code

09Environmental DNA10 detections

Where the DNA of Agrilus bilineatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 12.8–21.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.4 °C 19.7–26.3

Min temp (night)14.5 °C 5.80–18.2

Precipitation96.5 mm/mo 57.8–108

Air humidity58.1 % 50.0–59.7

Moisture balance-51.0 mm/mo -98.4–-19.8

Vapour deficit948 Pa 744–1,104

Wind speed2.70 m/s 2.50–3.90

Cloud cover38.8 % 27.7–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)