Agonum fidele

Casey, 1920 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records311

Data sources6

Biological traits0

DNA specimens21

eDNA detections1

Sources6 archives

Databases and archives Agonum fidele's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF311 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agonum fidele is a species of ground beetle from Platyninae subfamily that can be found in United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum fidele has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

34Amostly conserved

40Amostly conserved

43Gvariable

61Amostly conserved

82Tmostly conserved

163Amostly conserved

181Gmostly conserved

199Amostly conserved

202Tmostly conserved

220Cmostly conserved

235Tmostly conserved

284Tmostly conserved

298Amostly conserved

400Cvariable

416Gmostly conserved

499Amostly conserved

500Cmostly conserved

505Cmostly conserved

520Gmostly conserved

533Tmostly conserved

562Cvariable

622Gmostly conserved

628Amostly conserved

AACATTATACTTTATTTTCGGAGCATGATCAGGAATAGTAGGGACTTCATTAAGTATACTAATTCGAGCTGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes5

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum tenuesame genus2.4%Agonum moerenssame genus4.1%Agonum mutatumsame genus4.1%Agonum dolenssame genus5.8%Agonum viduumsame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type311 records

Wild obs. + sensor5

Museum / vouchered306

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2>10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 11≤1 km 5≤10 km 175

191 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence306

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Espace pour la vielocation not on record	69
OSUClocation not on record	36
Saint John, CA	26
Tempe, US	16
Cambridge, US	14
Decorah, US	13
University of Alberta Museums (UAM)location not on record	11
University of Guelphlocation not on record	3
Provo, US	2
Colorado State Universitylocation not on record	2
University Park, US	2
University of Alabamalocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
Washington, US	1
Essig Museum of Entomologylocation not on record	1
EWIClocation not on record	1

16 institutions · 200 of 306 vouchered records shown · 106 without an institution code

09Environmental DNA1 detections

Where the DNA of Agonum fidele was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

woodyWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter29.3 °C

Max temp (day)21.2 °C

Min temp (night)12.7 °C

Precipitation104 mm/mo

Air humidity58.4 %

Moisture balance-35.5 mm/mo

Vapour deficit773 Pa

Wind speed3.00 m/s

Cloud cover43.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)