Agonum moerens

Dejean, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records78

Data sources6

Biological traits0

DNA specimens25

eDNA detections25

Sources6 archives

Databases and archives Agonum moerens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD25 specimens

01Narrative

Agonum moerens is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum moerens has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections25

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

271Tmostly conserved

AACATTATATTTTATTTTCGGAGCATGATCAGGAATAGTAGGGACTTCATTAAGTATACTAATTCGAGCTGAATTAGGAAATCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum fidelesame genus4.1%Agonum melanariumsame genus4.3%Agonum trigeminumsame genus4.6%Agonum metallescenssame genus4.7%Agonum tenuesame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor9

Museum / vouchered69

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 7>10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
CUlocation not on record	10
Saint John, CA	5
Champaign, US	4
College Station, US	3
North Carolina State University Insect Museumlocation not on record	2
University Park, US	1

8 institutions · 48 of 69 vouchered records shown · 21 without an institution code

09Environmental DNA25 detections

Where the DNA of Agonum moerens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

Mixed HabitatGrasslandMixed habitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 16.7–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 22.2–24.8

Min temp (night)19.9 °C 13.9–19.9

Precipitation94.8 mm/mo 93.3–94.8

Air humidity58.0 % 58.0–58.3

Moisture balance-97.2 mm/mo -97.2–-47.7

Vapour deficit1,086 Pa 825–1,086

Wind speed6.10 m/s 2.60–6.10

Cloud cover39.2 % 39.2–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)