Agonum dolens

(C.R.Sahlberg, 1827) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records489

Data sources8

Biological traits0

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Agonum dolens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility489 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF489 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT · TreeOfSex2n = 40

01Narrative

Agonum dolens is a species of ground beetle in the Platyninae subfamily. The species is common throughout Eastern Europe and Central Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum dolens has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCATTAAGAATACTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum metallescenssame genus4.1%Agonum corvussame genus4.4%Agonum cupripennesame genus4.7%Agonum harrisiisame genus4.9%Agonum octopunctatumsame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agonum dolens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidy2× diploid · measured

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 393×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 403×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Serrano J, Yadav JS (1984) Chromosome numbers and sex-determining mechanisms in adephagan Coleoptera. Coleopt Bull 38: 335-357. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type489 records

Wild obs. + sensor91

Museum / vouchered394

Fossil2

Other2

Range

Area of Occupancy AOO1 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 48≤1 km 30≤10 km 4

82 georeferenced · 9 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 87≤1 km 146≤10 km 104>10 km 22

359 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence394

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FEBlocation not on record	55
SLU Artdatabankenlocation not on record	43
Olocation not on record	41
Tartu, EE	40
NHMOlocation not on record	36
Helsinki, FI	26
Kushiro City Museumlocation not on record	23
NTNU-VMlocation not on record	17
Copenhagen, DK	12
TMPMlocation not on record	12
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
Uniwersytet Wrocławskilocation not on record	7
Metsähallituslocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
Veterinary Laboratory Agencylocation not on record	5
Kuopio, FI	4
ZMAAlocation not on record	4
Montpellier, FR	3
ZSMlocation not on record	3
Bando, JP	3
Chiba, JP	2
LSMlocation not on record	2
MZLUlocation not on record	2
Philadelphia, US	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
�� ͳ�� -��location not on record	1
Oulu, FI	1
Stockholm, SE	1

28 institutions · 364 of 394 vouchered records shown · 30 without an institution code

09Environmental DNA3 detections

Where the DNA of Agonum dolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.8

Seasonal swing summer↔winter16.2 °C

Max temp (day)17.2 °C 17.2–18.1

Min temp (night)10.2 °C 9.40–10.2

Precipitation85.7 mm/mo 61.0–85.7

Air humidity64.1 % 59.0–64.1

Moisture balance12.7 mm/mo -43.6–12.7

Vapour deficit560 Pa 560–651

Wind speed4.50 m/s 3.80–4.50

Cloud cover39.3 % 34.4–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)