Agonum duftschmidi

J.Schmidt, 1994 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records316

Data sources7

Biological traits2

DNA specimens14

eDNA detections0

Sources7 archives

Databases and archives Agonum duftschmidi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility316 records↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF316 records

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex2n = 34

01Narrative

Agonum duftschmidi is a species of beetle from family Carabidae, found in all European countries except for Andorra, Iceland, Malta, Monaco, Portugal, and Vatican City.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum duftschmidi has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

25Amostly conserved

59Cvariable

82Cmostly conserved

97Tmostly conserved

220Cvariable

241Amostly conserved

340Cmostly conserved

343Amostly conserved

346Cvariable

400Tvariable

403Tmostly conserved

416Gmostly conserved

508Gvariable

613Cvariable

AACATTATACTTTATTTTCGGAGCATGATCAGGAATAGTAGGAACTTCATTAAGTATACTAATTCGAGCTGAATTAGGAAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes6

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum viduumsame genus2.9%Agonum hypocritasame genus4.0%Agonum lugenssame genus5.5%Agonum tenuesame genus5.9%Agonum fidelesame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Agonum duftschmidi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Chromosome records34–342n range34median34mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 343×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Serrano J, Yadav JS (1984) Chromosome numbers and sex-determining mechanisms in adephagan Coleoptera. Coleopt Bull 38: 335-357. ↗

08Occurrence & distribution

Record type316 records

Wild obs. + sensor217

Museum / vouchered94

Other5

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 75≤1 km 44≤10 km 51>10 km 2

172 georeferenced · 45 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 8≤1 km 23≤10 km 18>10 km 9

58 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	22
Natural History Museum Rotterdamlocation not on record	12
Helsinki, FI	9
Copenhagen, DK	8
Uniwersytet Wrocławskilocation not on record	6
ZSMlocation not on record	5
TMPMlocation not on record	5
Paris, FR	2
NTNU-VMlocation not on record	2
Tallinn, EE	2

10 institutions · 73 of 94 vouchered records shown · 21 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)