Agonum lugens

(Duftschmid, 1812) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records2 005

Data sources6

Biological traits0

DNA specimens32

eDNA detections32

Sources6 archives

Databases and archives Agonum lugens's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 005 records

Environmental DNA1 datasets · 4 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

Agonum lugens is a species of ground beetle in the Platyninae subfamily. It was described by Caspar Erasmus Duftschmid in 1812.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum lugens has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections32

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

418Tmostly conserved

433Amostly conserved

AACATTATACTTTATTTTCGGAGCATGATCAGGAATAGTAGGAACTTCATTAAGTATACTAATTCGAGCTGAATTAGGAAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum hypocritasame genus3.5%Agonum viduumsame genus4.0%Agonum corvussame genus5.2%Agonum dolenssame genus5.3%Agonum emarginatumsame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 005 records

Wild obs. + sensor539

Museum / vouchered1 432

Cultivated / captive1

Fossil1

Other32

Origin

Native186

Range

Area of Occupancy AOO1 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 194≤1 km 56≤10 km 201>10 km 7

458 georeferenced · 81 without coordinates

Open the mapobservation + sensor539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 41≤1 km 943≤10 km 325>10 km 5

1 314 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence1 432

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	857
SLU Artdatabankenlocation not on record	59
Tartu, EE	58
Bern, CH	34
Geneva, CH	32
Naturmuseum St. Gallenlocation not on record	28
Natural History Museum Rotterdamlocation not on record	21
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	16
Copenhagen, DK	14
ZSMlocation not on record	13
IPEM TASlocation not on record	11
Provincia di Livornolocation not on record	11
Tallinn, EE	11
Frauenfeld, CH	9
NMOKlocation not on record	6
Paro, BT	6
Uniwersytet Wrocławskilocation not on record	6
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	5
IZFRlocation not on record	4
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
NTNU-VMlocation not on record	3
TMPMlocation not on record	3
�� ͳ�� -��location not on record	3
Paris, FR	2
Helsinki, FI	2
�� -�� 㳿 ��location not on record	2
IFR-DNFlocation not on record	1
Kuopio, FI	1
�� location not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

30 institutions · 1 224 of 1 432 vouchered records shown · 208 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA32 detections

Where the DNA of Agonum lugens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map4 countries0

hiekkapohjainen ketoMarais sous tamarixRiedflÃ¤che

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 13.8–20.6

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.2 °C 15.6–24.9

Min temp (night)12.1 °C 10.7–15.6

Precipitation69.4 mm/mo 48.9–77.5

Air humidity58.6 % 56.6–60.9

Moisture balance-56.1 mm/mo -77.9–-26.7

Vapour deficit805 Pa 612–1,058

Wind speed3.40 m/s 2.70–4.30

Cloud cover37.4 % 34.6–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonum lugens

At a glance

Sources6 archives

At a glance

Record type2 005 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 005 records