Agonum aeruginosum

Dejean, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records206

Data sources6

Biological traits0

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Agonum aeruginosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF206 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agonum aeruginosum is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum aeruginosum has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

34Gmostly conserved

40Amostly conserved

58Avariable

82Tmostly conserved

148Amostly conserved

178Tmostly conserved

271Tmostly conserved

319Amostly conserved

364Tmostly conserved

391Cvariable

415Gmostly conserved

577Amostly conserved

625Amostly conserved

628Amostly conserved

631Avariable

634Tmostly conserved

646Tvariable

AACATTATACTTTATTTTTGGAGCATGATCAGGGATAGTAGGAACTTCTTTAAGTATACTAATTCGAGCTGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes4

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum lugenssame genus5.8%Agonum corvussame genus5.8%Agonum versutumsame genus5.9%Agonum suturalesame genus6.1%Agonum mutatumsame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type206 records

Wild obs. + sensor8

Museum / vouchered198

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 5≤1 km 2>10 km 1

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 1≤10 km 112

114 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Espace pour la vielocation not on record	50
University of Alberta Museums (UAM)location not on record	41
Provo, US	10
CUlocation not on record	6
Saint John, CA	6
OSUClocation not on record	5
University of Guelphlocation not on record	5
UDlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Colorado State Universitylocation not on record	3
University Park, US	3
North Carolina State University Insect Museumlocation not on record	2
University of Alabamalocation not on record	2
Cambridge, US	1
College Station, US	1
EWIClocation not on record	1

16 institutions · 144 of 198 vouchered records shown · 54 without an institution code

09Environmental DNA7 detections

Where the DNA of Agonum aeruginosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Mixed HabitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 14.7–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 19.9–24.2

Min temp (night)19.9 °C 10.4–19.9

Precipitation94.8 mm/mo 90.8–94.8

Air humidity58.0 % 57.3–58.0

Moisture balance-97.2 mm/mo -97.2–-29.6

Vapour deficit1,086 Pa 720–1,086

Wind speed6.10 m/s 2.60–6.10

Cloud cover39.2 % 39.2–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)