Agonum suturale

Say, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records137

Data sources5

Biological traits0

DNA specimens7

eDNA detections3

Sources5 archives

Databases and archives Agonum suturale's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agonum suturale is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1830 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum suturale has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

88Avariable

415Avariable

416Gvariable

534Tvariable

AACATTATACTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCATTAAGAATATTAATTCGAGCTGAATTAGGAAACCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum cupripennesame genus2.6%Agonum octopunctatumsame genus3.2%Agonum metallescenssame genus4.6%Agonum corvussame genus4.6%Anchomenus quadratussame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor18

Museum / vouchered119

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 8≤1 km 1≤10 km 4>10 km 4

17 georeferenced · 1 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 6≤10 km 2>10 km 4

12 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	90
University of Alberta Museums (UAM)location not on record	14
Provo, US	7
University of Alabamalocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	2
Chicago, US	1
Cambridge, US	1

7 institutions · 119 of 119 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Agonum suturale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 10.9–12.5

Seasonal swing summer↔winter22.1 °C

Max temp (day)18.4 °C 18.2–18.4

Min temp (night)4.70 °C 4.00–6.60

Precipitation45.4 mm/mo 18.0–73.6

Air humidity53.8 % 43.5–53.8

Moisture balance-91.1 mm/mo -139–-47.8

Vapour deficit679 Pa 655–748

Wind speed2.60 m/s 2.40–2.70

Cloud cover41.1 % 33.3–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)