Agonopterix vendettella

Chrétien, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records5

Data sources7

Biological traits0

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Agonopterix vendettella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Agonopterix vendettella is a moth of the family Depressariidae. It is found in France and Portugal and on Corsica and the Canary Islands. The wingspan is 18–21 mm.lepiforum.de The larvae feed on Smyrnium olusatrum.Further additions to the Lepidoptera of Algarve, Portugal

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix vendettella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

46Gmostly conserved

82Tmostly conserved

212Cmostly conserved

376Cmostly conserved

412Tmostly conserved

457Cmostly conserved

502Amostly conserved

508Tmostly conserved

514Cmostly conserved

562Gmostly conserved

574Tmostly conserved

622Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACGTCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes3

BINs2

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix curvipunctosasame genus2.9%Agonopterix carduncellisame genus3.6%Agonopterix latipennellasame genus3.8%Agonopterix omelkoisame genus4.0%Agonopterix scopariellasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 records

Wild obs. + sensor5

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced

Open the mapobservation + sensor5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA9 detections

Where the DNA of Agonopterix vendettella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.1–19.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)18.4 °C 14.0–23.8

Min temp (night)8.70 °C 6.40–16.2

Precipitation60.8 mm/mo 20.0–71.3

Air humidity58.1 % 55.7–64.1

Moisture balance-38.4 mm/mo

Vapour deficit736 Pa 490–926

Wind speed3.50 m/s

Cloud cover40.6 % 28.8–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)