Agonopterix curvipunctosa

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records567

Data sources7

Biological traits2

DNA specimens22

eDNA detections12

Sources7 archives

Databases and archives Agonopterix curvipunctosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility567 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF567 records

Environmental DNA1 datasets · 8 countries12 detections

DNA & barcodingBOLD22 specimens

01Narrative

Agonopterix curvipunctosa is a moth of the family Depressariidae. It is found in most of Europe, except Ireland, Portugal, Finland, the Baltic region and the western and southern part of the Balkan Peninsula. The wingspan is 15 -.microlepidoptera.nl Adults are on wing from mid August to May. The larvae feed on Anthriscus caucalis, Anthriscus sylvestris, Chaerophyllum temulum, Angelica sylvestris, Angelica archangelica and Seseli libanotica. The species overwinters as an adult.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix curvipunctosa has left across the world's sequence archives.

At a glance

DNA specimens22

BINs4

Marker genes1

eDNA detections12

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

49Tvariable

166Gvariable

181Amostly conserved

190Amostly conserved

206Cvariable

220Cmostly conserved

235Tmostly conserved

238Tmostly conserved

250Tmostly conserved

266Cvariable

313Tmostly conserved

364Cvariable

382Amostly conserved

385Tmostly conserved

386Cmostly conserved

415Avariable

418Tmostly conserved

442Cvariable

454Amostly conserved

457Tmostly conserved

484Amostly conserved

490Tmostly conserved

508Amostly conserved

514Tmostly conserved

562Amostly conserved

596Cmostly conserved

598Amostly conserved

616Tmostly conserved

619Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BINs4

Most divergent pair3.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix vendettellasame genus2.9%Agonopterix carduncellisame genus2.9%Agonopterix kayseriensissame genus3.3%Agonopterix multiplicellasame genus3.3%Agonopterix broennoeensissame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type567 records

Wild obs. + sensor485

Museum / vouchered82

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 43≤1 km 27≤10 km 383

453 georeferenced · 32 without coordinates

Open the mapobservation + sensor485

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 30≤1 km 22≤10 km 16

68 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NHMOlocation not on record	30
DanishLepidopterologicalSocietylocation not on record	26
SLU Artdatabankenlocation not on record	12
Provincia di Livornolocation not on record	2
ZSMlocation not on record	1
Staatliches Museum fuer Naturkunde, Karlsruhelocation not on record	1
National Museum of Natural History, Praguelocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1

10 institutions · 76 of 82 vouchered records shown · 6 without an institution code

09Environmental DNA12 detections

Where the DNA of Agonopterix curvipunctosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map8 countries0

a small village + surroundings

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 9.20–20.9

Seasonal swing summer↔winter21.1 °C

Max temp (day)18.1 °C 13.8–25.5

Min temp (night)8.80 °C 3.90–14.7

Precipitation65.1 mm/mo 40.2–98.8

Air humidity57.2 % 53.9–62.0

Moisture balance-42.3 mm/mo -71.4–-21.2

Vapour deficit599 Pa 495–1,087

Wind speed2.90 m/s 2.10–3.80

Cloud cover38.1 % 20.6–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)