Agonopterix rotundella

Douglas, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records80

Data sources7

Biological traits2

DNA specimens36

eDNA detections30

Sources7 archives

Databases and archives Agonopterix rotundella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 11 countries30 detections

DNA & barcodingBOLD36 specimens

01Narrative

Agonopterix rotundella is a moth of the family Depressariidae and is found in most of Europe. It was first described from moths found in Surrey, England by the entomologist John Douglas in 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix rotundella has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections30

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

172Cvariable

184Gmostly conserved

220Cmostly conserved

295Amostly conserved

298Tmostly conserved

539Tmostly conserved

542Tmostly conserved

544Amostly conserved

616Tmostly conserved

628Gvariable

634Tvariable

637Cvariable

640Cvariable

641Cmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes18

BINs2

Most divergent pair2.6%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix nodiflorellasame genus4.1%Agonopterix carduncellisame genus4.4%Agonopterix walsinghamellasame genus4.5%Agonopterix broennoeensissame genus4.7%Agonopterix squamosasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor60

Museum / vouchered18

Other2

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 20≤1 km 27≤10 km 8>10 km 1

56 georeferenced · 4 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	4
South Kensington, GB	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Natural History Museum Vienna, Research Collectionlocation not on record	1
University of Copenhagen, Natural History Museum of Denmark, Zoological Museumlocation not on record	1

5 institutions · 9 of 18 vouchered records shown · 9 without an institution code

09Environmental DNA30 detections

Where the DNA of Agonopterix rotundella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map11 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 7.40–20.8

Seasonal swing summer↔winter18.6 °C

Max temp (day)17.8 °C 11.0–25.9

Min temp (night)9.50 °C 3.10–15.1

Precipitation69.7 mm/mo 22.3–92.3

Air humidity58.3 % 53.5–61.0

Moisture balance-46.1 mm/mo

Vapour deficit651 Pa 435–1,124

Wind speed3.50 m/s

Cloud cover39.9 % 30.7–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)