Agonopterix walsinghamella

(Busck, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records168

Data sources7

Biological traits0

DNA specimens45

eDNA detections1

Sources7 archives

Databases and archives Agonopterix walsinghamella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF168 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD45 specimens

01Narrative

Agonopterix walsinghamella, or Walsingham's agonopterix moth, is a moth in the family Depressariidae. It was described by August Busck in 1902. It is found in North America, where it has been recorded from the north-eastern United States and Canada.Moth Photographers Group The wingspan is 20–22 mm. The forewings are deep crimson red, irrorated (speckled) with black and cinereous (ash-gray) scales. The costa is broadly tawny red nearly to the apex, with veins nine to twelve strongly indicated by cinereous and irrorated with black scales and with poorly defined fuscous spots on the extreme edge. The discal spots are white. The first discal spot at the basal third is edged with carmine and the second at the end of the cell is preceded by a few carmine scales. The hindwings are light fuscous.Proceedings of the United States National Museum The larvae feed on Comptonia peregrina,Bug Guide Myrica aspleniifolia and Myrica gale.Agonopterix at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix walsinghamella has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

118Tvariable

172Tmostly conserved

287Tmostly conserved

406Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes7

BIN1

Most divergent pair0.66%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix scopariellasame genus2.5%Agonopterix carduncellisame genus2.5%Agonopterix ferulaesame genus2.7%Agonopterix atomellasame genus2.8%Agonopterix kayseriensissame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type168 records

Wild obs. + sensor76

Museum / vouchered92

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 48≤1 km 10≤10 km 6

64 georeferenced · 12 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤1 km 11≤10 km 18>10 km 1

30 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
East Lansing, US	12
UNHClocation not on record	10
New Haven, US	7
Cambridge, US	6
St. Paul, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2

8 institutions · 58 of 92 vouchered records shown · 34 without an institution code

09Environmental DNA1 detections

Where the DNA of Agonopterix walsinghamella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)